Pan_troglodytes Locus ENSPTRG00000029526
snOPY snoRNA Orthological Gene Database
Pan_troglodytes ENSPTRG00000029526
Pan_troglodytes
ENSPTRG00000029526
6
SNORD50, SNORD50
2064..2133, 2353..2425
3638
AAATACTGAAATGTTCAAATGTCGCGTGCACACACACACACGCAGACATATTCACTCGA
ACATGCTAATTAATCAAAGCACTGCTTTTGAATTTTGTGTTTGTCGTCTGGATAAAGTAT
TCAGGGATACTTCTCAAATTAACCTTTCTCTCGTTTTCAATATAACTAATTGAGTACAAA
GAAGTTAAAAATTAGCAAAGCATTTCAGCTGTGTGACCTTAGGCAAATTACCTGGCTGTT
TTAAGCCTCAGTTTTCTCCTCTGCGAAATGGAGTATTGAACCTCACGTTCGCGGTTTGAG
GGAGACTTGTATGGTCACGTTTAGTGTAACCGGATGCCTGGCACGAGGAAGCGTGAGGAG
GAATGGGTCCCCATGGGGCCTTGATGACCGCCCTGAGGCCCTGCAGGGCCGCACGCCGGG
GCTGTTCTCACGTGGCGCTTTCCGCTTTTTCACCCAAGCGTTTCTGCCAGCCAACTGCCC
TTTCCCGGAGTGCTGCGGCCAGAGCTCGCCCGCTCCTCCGGCGGCCTCCGCTGGGGGCCC
ACTACAGCCCAGCGCCGGCCAGCCAGCCCAGCTTCTCGAATCGGTCCTAAGCTGAGGCCG
CCCTGCGCTGCAAAACTTGTGTCCACTCTCGGACCCAATCTGTTCTGGACGGACTTGGCT
CGTGGCAGGCGAAAGCGTCGTTTCCAACTGCAGCTGTTTGAATTCTGGCGCCACACCCGC
GCCACGTAGGGCCAAGTCGGCCGCCAGACTCGTAAGCGACGCTTCGCAGTGCGCCTGCGG
GCGCGCGCCGGGAAATGGCCGGGCGCGCGGCCGGCCTGCGGCGCGCTCCACAACGCGGAA
CGGGCCTCAGAAGAGCCACCGCGCGCGCTCCCGCTAATTCGCGACCACACCCCTGTCTAC
TTCCATGTCCAATAGGTGCGAGAGGGCGGGACGGCCTCGTTCTGACTCCGGGAGGCTATA
TAAGGAGCTACTGGCTGCGCACTTCGGTCTTTTACGTCGGCCTTCGCGAGCGTTTGGTCG
GGTGGTAGGTGAGTGGGTATTGCGGGCCAGTATCCGAGCAAAAGATGGTGGCGCAGGCCG
AGTTAAGAGCTTTAATCCTGTGAAGCCATCTTAGTGAAGAGTTTAGAGTGCTGAGAGTTG
AAAGCTTGCACGTGGGAAACGTGCGGCCGGACCGCCACATGTACTGAGGTTGAGTCGTGA
CGGCCACAGGCTCCGAGTTTTGGCGTGAGGAACCGCTGATCGGCCACGGGCACCGAACTT
GCTGGCCTCCGGCATGTGCCTGAGGGGCGGCGGAAAAACCACCTTAATTGGGGCGGAGGG
TTAGTTTTAAGAGCAAAGGGCCTTTACTAAAATGGCGAAGGCCTTCCGTCGGCGTTGTTT
TAAAATGGGAAGCCTCGACCCTGTATTGAAACTGAGCTGTTCGAAGGCGGCGTTGTGTGC
AATTCGGATTAATGAAGGGGAAGGGTTTTGTGTGGAAAAACGCCTTGGAGTGTGACATTT
CTGCGAGAATGCTTAAATACCGATTTCCCGCAGGAACAATGGCGCTGTCTTCAGTGGCAC
AGTGGAGCAGCTCTGAAGATGCAAAGGTAAGAGCTTAGTTAAGCTTAGTTTCCAAACTAA
AGGAGTAAACCTGTTGATTTACAGGAATAGGAACTGTTGCATCGTTTGAAATTTACTTTT
TTTTTGTTAGATACACGAAAAAACTTCCAGAACATCTGGGAGAATATTTAATGGAAAATC
GCTTGGTTAAAACCTGACACTCTTAACAGGTATGTGTTGTTTTAGTACTTTATGATTGAG
CATACCATTTAATCCACACCTAAACTAAATCAAATTTTTTTTGTCAGTGAACAGCGTTCT
GAGTGTGGACGAGTAGCCAGTGAAGATAATGAATGTCGAACGTGACTGACTAGCAGCTTC
ATTTTGAAGTAGGTTGTATGGCTTAAAACTTCTGTAGTATTTGTACTATAATACTTGCCT
TTTAGCATTACCTTGGTTTGTGGTCAGTGTCACAGAAGTGCAGTTTAATGTATTATGTGT
ACATATACAAGGTCTGATTGGTCTAATCAATGATGAAACCTATCCCGAAGCTGATAACCT
GAAGAAAAATAAGTACGGATTCGGCTTCTGAGATTAAGACCAGTAATTCAGAGGTGGAGT
AAATTTTGTTGCCGTGATTTTATAACAGTTGTGTTATAAAATCCTGGGGTTTTTTTTTTC
TGCCAACAGTGAGGGTCGCTGTCTGCCCATTGATAGAGGCCAGATTGTCTTGGAAGTTCC
AAAGTTGCAACGATTTCTGTAAGTGGAGTTTTTCTGTTTGCTTAGAGATCAGTGAATATT
GTGTCCTTGGTCTTATCTGTGATGATCTTATCCCGAACCTGAACTTCTGTTGAAAAAAAA
ACTTTTACGGATCTGGCTTCTGAGATGGACCGTTATAAGGACAATACTTTTTTTTTTTAA
TACTTTTAATGCTTTTACATATGTTGTAATGTTTGTAGTCTTGTAAGAATCTCGTGTTTT
TCCTTTTCTAGGGCTAGTGCCACGAGGTTTACTTGACTGTTGTGTGAAAAGCTGATAAGA
AAACCATCCAGAAAAAAGCTCTTCGTTTTACAAACATGAAAATAAAACATGTAATTTTGG
ATTATGTTCCTTTTTGTTATTACTTTTAAATAGGTCCTGAAATAACATGGGGAGCATTAA
ATGGAAAATCCACTAACCAGCCTTGTAATCAAATTACTGTGAGTGAATGTTTCGGGTTTG
TGCAGGGTACAATGTAAGGGTTTTTGGATCAGTGTAAGAGTGGAGAGACAGGAATTAGAA
GTAATTGTTACTAAGCAAATCATGGAATATTTAGTTTTGATGTAACTATAATTTTGAAAG
CCTGGATGCTTAAGTTGAGAAATGGGGGAATGAGATACAGAAAATAAGGAGCACAATAGA
ATAATAATAGCAGTTTATTAAGTATGGTCATGAGGGAAGGTTACTGATAAAACAATCTGG
TAAAGACATTCAGGCTTGCTAAAATCTAGGAAGAGGTCATTTGGCAGGATGGGTTACATA
ATACTATCTGATACTACCAAATAAAATGAGAGAGAAGCCTTAGGCATGTAACATTTGGAG
ATAGAAAATGTACCTTCACTATGAAGGTAGTGTGTGTAAGATGGCAGTTGAAAGCATTGC
TTGCGTTTATATTTATACCCTTGATCTCTGATGCCCTTACCTGCTGTACTTAAAACTCTG
TTAATCATTGTCTTTCTCCCCCTCCCACAACTTCTGCATGAAATTTTAAGATCTGTTTCA
TTAGTTCAAGAGTGCCTAGAATAGGGCCAGGCACTGTTATACAGTATGTGGTAAAAGACT
ATTGAGATTCCAGTTTTCAAGGAAGAGTGCCATTACCCTTTTGTTAAAGCTGGCAAACAA
GACAAAGTTGTGAAATAGACTCTTTGCTTTGGAGCCCTCTGACCGCTTTTCCTGTAGCTC
CTTCTACCTCCCTTGCCTCCCAATAGGTTTTTTAATATGTCACATTATCTATCGAAATTA
GTACTCCACATTTATATGCACTGGCTTGTGCTAGGCTCTGCCAAGACTCCTGAAATAAAA
CACCGTTTTGTCAATAGTGGCACAAGATGCCAAGGAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1585, 1690..1768, 1847..1927, 2229..2297, 2531..2638
1508..1585, 1690..1746
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved