Pan_troglodytes Locus BAT2
snOPY snoRNA Orthological Gene Database
Pan_troglodytes BAT2
Pan_troglodytes
BAT2
6
SNORA38
3427..3558
19476
CTATAATATCCTGTGCATTATCTCCAGCGCCTTCAAATCATAGTCACTGAATGATCTGT
TGAATGGGTATAACTCTGATGGGAGCAGAGAGTTCTAGAATCGGGTAGTAAGAGACAAAG
AAGGGTAACAGTACTGCATTTCACAAAATGAAACCCATTGTTAAGAAATTACAAATTCCC
AATAATTTCAAATATAAAAATTTATTCACGAAAATTATAGGTTATAAAATTAAATGTCCG
TCTTAGTCGATGGTTGCCCATATTTTGATGAACGAGTCATTCCTAGCCTATCTTTGTTCA
AATGATTTGCATATATTATGCAAATAGGTAGAACTACCCGAAGAATGCTTACGCGGCGTG
GTGCGGACGAAACGCTTCCCGGGGCCTTTGGATTGGTCTGTCTAGCCACCTCATTTGCAT
GACATAATTTAATAACTGGAAGGCCCCGCCCCTCCGGTGCATTTCCCCGCTCCAACCACC
TCCTCAAACTCACGGCAAAGGGACGCGAGAGCTGGAACTCTTACCAGGCCTGCGGAAACT
CAGCCCTCCGGCAGCTAATCCCGCCCGCCAGCCCCCGTCCTCTCTTTCTCCCTAGCTGAA
GGCGCCACGGGCCGTGTGTCGTTGCCTTCCACTTTTGGCGTCCCTACGTCTCTCCGCTCC
CATCTTTCTACCAACGTCCGACGCACGCTCCGCCTCTTTCTCCCACATTCGTCGTGTAAA
TTCTGCGTCCCAACCGCCCAGCCGACCTGCACCGCATTCCCGCCCCCTCAACACGTCTCA
ACGGCCGACGCTGGGGGCCCGCCTCCTTAGCCAATCGGGGTCCTAGTGCCCTTAAGTCCC
TCCTCTTTATGTAAATAACCTCCGCATGCTCCGCGCGCTCGGCCCTTTTTTTTTTTTTAA
ACTAAAGACAGCCCTGGAAGTAGAGGGTTAGGGTAGAAAGTACCCCGCCCTTTATGCAAA
TCAAGGGGCGTGTCTAGGCGCGGAGGGAGGTGGGAGGTGGGAGGGGGTGCTCCCGGGGGC
GGCGGTTGCCCGGATGGGCCGTTAGTCGGAGCTCAGCCGCGGAGTGAGCGAGGGAGACGG
AAGGAGCCGAACCCGGCGCCATCCGCCGCCATCCTCCCCCGCCCCACCGCCATCCCGTCC
CGGGGAGCCCCTAGGCCCGGGTCCCGGATCCCCGCGCACCCGGCCAGGTGAGTCTGGGTG
AACCGTGCGCTGACGCCCTTTTCCGGCGCGGGAGAGGTGGTGGTGGTGGTGGTGGCGGTG
GCGGTGGCGGCGGCGGCGGCGGCGGCTGTGGTGGGCCGGGGGGAGGAGAAGCTGCCATTA
GCCGCCGCCATTTTGTCCTCCTGCTGCCGGGCCTGCTTGCCCCTCCCCCTCCGGTACCTC
TACTCCGGGACCCGCACCTCCGGCAGTTCATTCAGGATCCGTAGTCTGCCCCTAACCACC
CACCGTCTTGGCTTCAGGGGGTGACCCCTGCGCCTGGGTCCGTAACTCCCTACCCTCCGC
TGCGCTCCTGGCTTTTCACCCCCATTTGTGGGCCCCCTCCTCGGCTGCCGCCCCGTGGTG
GGCCGCGCCCGACGGTTCTCTCGGAAGGGCGCTTTTCCTCCATATTGGACCCCCTCCTAT
CATCCAGCGCTGTGTTCCCCCCTCTGGACGCCCCTCTTCGTGTCGAGCCACTCCCACTCT
AGAACCCTGCTTTTATCCCAGCATCTTTGCTTTCTATGTTGCTCAGTCGCCCTATGTCTG
CTTTTTCATTTTTCCTGTTCCTCGTCTCCTTTCTCCCCCAACCCCGTTTTTCTTCTTGGG
CCTCTGCCCCCTTACTTCGTTGTCTACATCCTTTTTTTTTTTTTTTTGCCATTCCTGTTT
CCATATATTTTCCACCTGCTTTCGTATTCATTATTTTCTGTTAGTTTTCGTCTATTCGCT
ACATGACTCTTGTATTCGTTTTCCCTTCATATATTTATCTTCACAGATTGGCCTCCTCAA
ACACCTACGAAGCAACATCCATCTCATCTCTAGCTTGTCATAAAGTTCTTTCTCCCCAAT
TTTAGCTTTCATTCTGGGCCTGTCTGGATTTCCCTGCTTTCTTCCCCACTATTTCTTATC
TCTCTACACTGTTCCCGTCCATAAACGAATGCCTGGTCACTCTGGAATGGACGGAGAGAC
CTGTCGTCCGGCTTGCTTAGGGAGCTGGAGGTATCGAGTAAAGAAACACTGGTGATGGAC
ATTTTTAATGAGGATAGGAAAATGAAGATGGCTGTGGCCTTGGCCCTCTGTTTTCTGGCC
CATGGTTACAGGGTGCTAAGGTGGCTCCATAATGCTTTTTCTCAGTTCTTCATATGGTAA
AACAGTATTTCATCTGGAGGCGATTTTTTCCAGGAGCCAATACAGGAGCAAGTTTAGGAA
AAGATGGGATATTTCAAATACTTGGGGTTCCTGTAGCCTGGGAGTATGTACAGCCCCAGT
TGTTCTATGAGGATTTCTCTGGTACCAACCCCCATTCCGGCTGAGCAAGCTCATAAAATC
CTTAAACTCCCAGCATACCTTCCTGCAAACCTTCCCAGATGGACACGAGGCTGCTGGGCT
GGGAGCCTGGGGTACAGGGCCCTGGGGGCATGATTAGGGAGCTTGTGTCCAATAAATAGG
GAATCTAAAGTGTTGTTTCTTCTTCTCTGATGGAATTGTATGCTTCTTTTTTAGTTTTCT
CTTGCTTGAATTTGTCCTGTTGTAAGTCTCTGAAACGATTTTGGTGGAGAGAGAAGAGAT
TATTACTTGTAGGGAATTACTCTTTGTAGACAGGCACAAAGGGCAGAGTGTTTATACTAG
GAGAATGCTGGATTTTTACTTAGATTTCCTTGACAAAGGTGTCTGGGGGAAAGGAGGGAA
CATGGCATTTGAGCTATGAGGGAGCTAAGTAGATCATGGTTGCTTAAGAAGAGTGGGCAG
TTTACATAGACTGGAGGAAAAGACACCAGAGGGCCTCATATCTGAGTCCCTAATGATAAT
GCAATGGAGTTTTTAAGTTTCTGTTATGGTCTGTACAGGGGACAGAGACTGAGACACTTG
CTGTCTGGCCCACAGGCTCCGGCACGTTTTGGGGGAGGTGCCTGCGGGACCCAACATACT
CAATGAGCTTCCAGCGCAATGTCCGATCGCTCGGGGCCGACTGCCAAGGGAAAGGATGGA
AAGAAGTATTCCTCGCTCAACCTGTTTGATACGTATAAGGGCAAGTCCTTAGAGATCCAG
AAACCCGCTGGTGAGAGTCCTGCAAAGATGCTTCTGATGGTTGAAAGCTAGGCATGCATG
GGGCATATGTTTTAGAGCTCTTTAAAGGGAAGTGGCTGTAGTAGAAATACCAAAAGACTA
GAGGAGATTTCCCAACTTTACACTGGGTCCTTTAAAGGGGGTGTGGGCTCTGGGTGAACA
CCAGTTATCCTCCTACAAAGGCGTGTCTGTGGTTCCCTGTCTTTGGACACGTAAGAATTG
GAGGAAAATAAATGTGGATTTGGGAAACTTTGAGGCCAGCTTGCTTCTTGCAGGCTCATG
ATCAACCAATCTCACATAAAAGTATTGAATGTTACATATCTCAGCCTTCTTGATAGGGAT
TTCATAGATTTTTTTTTTTTTTTTTTTTTTTTTTTGAGACCAACTTTAGCTCCTGTTGCC
CAGGCTGGAGTGCAATGGTGTGATCTTGACTTACCACAACCTCCACCTCCTGGGTTTAAG
CGATTATCCTGCCTCAGCCTCCTGAGTAGCTGGGATTACAGGCATGCGCCACCACACCCG
GCTAATTTTGTATTTTTAGTAGAGACAGGGTTTCTCCATTTTGGTCAAGCTGGTCTTGAA
CTCCTGACCTCAGGTGATCCGCCTGCCTTGGCCTGCCAAAGTGCTGGGATTACAAAGTGT
GAGCCACCACAATCAGTGCGATTTCAGAGATTATTAAGGGCAGGGGAGGGAATCCCTTCT
AAGAGAAGTTTGGAGGAAGTAGGTAATAAAATATTCAACACGTATAAATGTGTCCCAGGA
TAGGAGGCCATCAGATCTCCCATATGAGGCATTTTCGACCCTCTCTCCGTCTTTTTCTCC
AGTTGCCCCTCGTCATGGCCTGCAGAGTCTCGGGAAAGTTGCCATTGCCCGGCGTATGCC
ACCTCCAGCCAACCTTCCAAGCCTGAAAGCCGAGAACAAAGGCAATGACCCCAATGTCTC
ACTAGTGCCAAAAGACGGAACAGGATGGGCAAGCAAACAGGAGCAGTCCGACCCCAAGAG
GTAGACAGAGGCTTGGGGGACCTAGAGTGATGGGTATTTTAACTTGAACTTCAGGGAGCA
TTGGGGCTTGGTTTAGTCCAGCCACGTCTGAGCCAGAGACGAAGAGAGGTCCCTTTCTTA
CCTATTGCAGGTTCCTTGTTAAATGACTAAGGAATGGTACTAAACTTTAGCTTTTTGTCT
TGGAGAGAGAGCATGAAAAAATAGACAACAGCCTACAAAGGATGACAAAATTATTTTGTC
CTTATATTTGTAAATGGTAGCAATGGGCATGATTTCAGTCCTGAGTCTCCACCAGTTGGA
GAAGTCAGGGAGGCATCTCAGGTGTGAATAACCTTCCCATTCTGTCCCCTCAGTTCCGAT
GCCTCAACCGCTCAGCCGCCGGAATCGCAGCCACTGCCGGCTTCACAGACGCCTGCCTCC
AACCAGCTGAAACGACCCCCAGCAGCCCCCGAGGTACCTGGAGAACTGGAGGGGTGGGGA
GGAAGAATGGTTCATAGCTGCCCCACCCACATCATTTATCATCTTTCTGAACACTTCCCC
AGAACACTCCTTTGGTTCCAAGCGGGGTAAAGTCCTGGGCACAAGCCAGCGTCACCCATG
GAGCACATGGAGATGGTGAGTGCAGCACTTAATTGGGGAGCTGTGTCTGGGCACCATGGG
ATGCATGAACCCTGCACTGTATTTTCAGCCAAGTGACCTTGGTCCTCTTTGGCTAAATCA
AGGACCACCCATATTCAGTTTCATGGAGACACATGAGCAAGTTTAAGTCTCAGTCTTATA
TGATGGAGTGTAGTGGTGCCAGAACTGACCTCCTTGGGGAATAAGTAGTTATTCTGTAGG
GGGGTGAGTTTGAAGGCGGGAAACCTGATGGTCTGGTACCTGTCAGAGCCTTCCACTTTT
TTTTTTTTGAGACGGAGTCTCATTCTGTCACCCAGGCTGGAGTGCAGTGGCGCAATCTCG
GCTCACTGCAACCTCTGCCTCCTGGGTTCAAGCGATTTTCCTGCCTCAGCCTCCAGAGTA
GCTGGTGGGACTACAGGCACACGCCAACACACCCAGCTAATTTTTTTTGTGTTTTTAGTA
GAGATGGGGTTTCACATGTTGGCCAGGATGGTCTCGATCTCTTGACCTCGTGATCCGCCC
GCCTCAGCCTCCCAGAGTGCTGGGATTACAGGCGTGAGCCACCGCGCCCAGCCAGAGTCT
TCCACTTTTATAGCATGTCCTCAGGAAATGTACTTCTGTCTCCTGTTCTGCATCCCCATC
CTAATAGGTGGAAGGGCATCAAGCCTACTGTCGCGATTCTCTCGAGAGGAATTTCCGACC
CTGCAGGCGGCTGGCGACCAGGACAAGGCTGCCAAGGAAAGGGAGTCTGCCGAACAGTCG
TCTGGGCCCGGACCAAGCCTCCGCCCCCAAAGTGAGTGGCTGCCTTTTGGCCAAGACATT
ACCTATTGCATCTCAGAGCTAGGTGCTGGCTTATTCACCTTCCTCCCCATCACTTTCAGC
TGTGTTCACTTGCCCTCCAATCATTGATACCTCTCTCTACCTTTTCCAAAATACAGATTC
TGCAACTTGGAGGGACGGAGGTGGGCGTGGCCCTGATGAGCTGGAGGGCCCGGACTCCAA
ACTTCATCATGGTCATGATCCCCGGGGTGGGCTACAGCCTTCAGGCCCACCCCAGTTCCC
TCCCTACCGCGGAATGATGCCGCCTTTCGTGAGTCTTGGTGTCTTGTCTTGGAATGATTA
CACTGGAAGCTGGAGAGCTAGGAATCAGGACTTAGTCTTTGACCTATGAGATAGAAGGGA
GGGTGGGAGGATGATTAATAGCAGGCTTAAGGAGCTAGAAGGGTATATGACTGTCCCTCT
GAGCAGCTACTGTTGGACCCTTTTACAGATGTATCCCCCATATCTCCCGTTCCCTCCGCC
CTATGGACCCCAGGGGCCTTACCGATACCCCACTCCTGATGGGCCCAGGTGAGCAATCCA
GGTCTGGGTTTGTGGCTGGGGGCAGGGGAAGCTTATTGGGGGAGGAGATGGTTTTCTAGC
CAGGAGGCTCAGTCTAGGATCAGTCTCGCATGTGGTTATACAACATGCCATATTTCATTT
TTTTGTGTGTGTACAGCCGTTTTCCCCGTGTGGCGGGCCCCCGAGGCTCAGGGCCACCAA
TGCGCTTAGTAGAGCCTGTGGGTCGTCCCTCTATTCTCAAAGAGGATAATCTCAAAGAGT
TTGATCAGTTGGATCAGGAGAATGATGATGGTTGGGCAGGTAAGTGGATATTAAGGGTCA
AGAATTTGGATCTTGAAAGGCAAAACCTAATGAGGAAAAAAAAAAAAAATACAGGGTTAT
GTGGGTGAAAGGCAGACATTGAAGTGTAGGAAGACCAGGCCGAATGGCTCACATCTGTAA
TCCCAGTGCTTTGGGAGTGTTAGGTGAGAGGATCGCTTGAAGCCAGAAGTTCAAGACCAG
CCTGGGCAACACAGCAAGACCCCCCCACCTCTACAAAAAAAAAAAATGTTTAGTTGGGTG
TGGACTGTGCATCTGTGGTCCCAGCTACTCTGGAGGTTGTGGTGGGAGGATCAGTTGAGT
CCAGGAGTTGGAGGTCACAGTGAGCTATGATCGTGCCACTGAACTCCATCCTGGGCAACA
GAGCGAGACTTTTAAAAGGAAAAAAAAAAAAGTAGGGGAGGATGGATGAGGAATACCAAG
TCCTTGCAAAGTGGTGAGAGGAGTAAGAATGACAAGACTTCATTGGTGGATCTAGACTTC
GGAGGGAAGGATGTTGGCATTGGTAGTCCATCTTGTTACATAGTTCCAGACTACCTCCCA
AGATTGGAGGGCAGAATGCTTGGGTTACTAATACTCATATTTCCCCTCAGGGGCCCATGA
AGAGGTTGACTACACTGAAAAGCTCAAGTTCAGCGATGAGGAAGATGGGCGAGACTCTGA
TGAGGAGGGAGCTGAGGGCCAGTGAGTTAGGGCCATCAGGGGAGAAGAGGAGGGGGTCTT
GGTTTGTATTTTGGTAATATACTCTTAGAGGAGTATATTAGTTGCAGCTGATTTTAATTT
CCACTGTTGATCTGCTCACAGCAAGGATTCCCAATCAGCTTCTGGTGAGGAACGGCCCCC
TGAAGCAGATGGCAAAAAGAGCAACTCCCCCAACAGCGAACCGCCAACTCCTAAGACGGC
CTGGGCAGAAACCTCTCGGCCTCCAGAGACAGAGCCGGGACCTCCTGCCCCAAAGCCTCC
CCTACCCCCACCTCACCGGGGCCCCGCCGGGAACTGGGGCCCCCCTGGGGACTACCCAGT
GAGTGTCTCCAATAAGGGATTGAGAGGGTCAGCTGTGGGAAATTGGTGTCAGCTGAGTAA
TTGAAGCGGTTGTGATACAGAGGAAGGGGGGTGCTAAAAATGGGCTGTGTGAAGTGCCAG
GCTGCAGAACATCCTGGGAAGCTTTTAAATATCTTTGGTAATAGGGGAGTCTGGGTAAGA
AGTGAGAAACTGGGATGCTAATGAGGAAAGAAGAAAAAGGAGCCCTGGGTGTTTGGGTTT
CTGAAGGAGAGAGGGAACAGAAAAATAAAAAGACTAGGGTGGCTAGGTAGCTGGATCTGC
TAGTATGCATCTGTAGTCCAAGCTACTCAGCAGGCTGAAGCAGAAGGATCACTTGAGCCC
AAGTTCAAGACCAGCCTGGGCAACATAGCAAGACGTGGTCTCAAAGAAGACCAGGATAAT
GAGTTTGTCACCACCCAGAGAGATCAACCCCAAAGCCTGGGTCGTTGCATCCTGCAAGTA
GCGACAGTTGATTTGTCTGTAAAAGAGATGGTAGAAAGCATGGTAACTGATTCCCCTGGC
CCTGCTGGGTCTTGCCAATTGACAGGATCGTGGGGGTCCTCCCTGCAAGCCCCCAGCACC
TGAAGATGAGGATGAGGCATGGCGGCAGCGACGAAAGCAGTCGTCATCTGAGATTTCCCT
GGCAGTGGAGCGGGCCCGGCGACGGCGAGAAGAAGAGGAGCGGCGCATGCAAGAAGAGCG
CCGGGCAGCCTGTGCTGAGAAGCTCAAGCGACTCGATGAAAAGTTTGGGGCACCTGACAA
GCGGCTCAAAGCAGAGCCTGCTGCCCCACCTGCTGCCCCTTCTACCCCAGCTCCACCACC
TGCAGTCCCTAAAGAACTCCCTGCACCTCCAGCTCCACCTCCAGCATCAGCCCCAACACC
AGAGAAAGAACCTGAAGAGCCAGCACAGGCCCCTCCTGCCCAATCTACTCCCACTCCAGG
TGTGGCTGCGGCTCCCACTCTGGTGAGTGGTGGTGGCAGTACCAGTAGCACCAGCAGTGG
CAGCTTCGAAGCCAGCCCAGGTATGGAGATGGGGATAGGTACTACCAGATGTCAGATCAC
TGCTTCAAGGTGCTTAAAGGTGCAGGGTGGTAAGGCTGGGGATAAATGAAGTAGAAGGCA
GTTGTTTTGGTTTATTGGACTATCAGTGATAGTGTTCTGTCATTTGTATATCTGAAGAAG
GGAAGGTTTTGTCTGGAATCTTAGGTTGTAGTCTAATACCATTTCTTGGCAGAGTACTGT
AGCTCACGCCTGTAATCCCAACACTTAGGGAGGCTTGGGGTGGAGGATCGCTTGAGCCTA
GGGAGTTTGAGACCAGCCTGGGCAACAAAGCAAGACCCTGTCGGCCAGGCATGGTGGCTC
ACACTTGTAATCCCAGCACTCTGGGAGGCCGAGGCGGGCAGAACATGAGGTCAGGAGTTC
AAGATCAGCCTGGCCAACATAGTGAAACCCGTCTCTACTAAAAATACAAAAATTAGCCAA
GTGTGGTGGCATGTGCTTGTAGTCCCAGCTGCTTGGGAGGCTGAGGTAGTAGAATCGCTT
TAACCCGGGAGGCAGAGATTTCTGTGAGCCAAGACCATGCCATTGCACTCCAGCCTGGGT
GACAGAGCAAGACTCTGTCTCAAAAAAAAATCCTGTCTCACAAGAAATACATAAATAAAA
ATGAAAACTATTTCCTGTAGGCCAAGACTGAGGAAAGTACTGTTATTCTAATGGTTTCAT
AGAAAGTTAATGCCACCACCATAGGCTCATGAGAGGCCATGAAGTGCTTTAATGGGTCTT
AAATGGGAGGGGCTTCAATAGAATAGATGTTGAATAGAATATTTTAGTCTTAAGGGAGCT
AGAGATGAGACGTGATATTCCTGGGGTGTTCATGGAGTGTCTATTGTTGGACTAGATCAC
TCTGTTGTGTTTTTTTCGATGCAGTGGAACCACAACTGCCCTCAAAAGAGGGTCCTGAAC
CACCAGAAGAGGTTCCTCCTCCTACCACACCCCCAGTTCCAAAGGTGGAACCCAAGGGTG
ATGGGATTGGTCCCACCCGCCAGCCCCCTAGTCAGGGCTTGGGCTACCCCAAATATCAGA
AGTCGTTGCCTCCTCGTTTCCAGCGGCAGCAGCAGGTGAAATCAAGTTGTTTACCCTCTA
AGGGCTGCTTTTCTTCCTGGCTTCGGTCCCTAATTCTCTTCATAAGTTACCTTCTGGGTC
CCTTTGCTTCTTTGTCCCAGTTGTCTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGGTGGATTCCCTTTCC
TAGGAGCAGCTCCTGAAGCAGCAGCAGCAGCACCAGTGGCAGCAGCATCAACAGGGCTCT
GCCCCTCCTACCCCAGTGCCCCCATCACCACCACAGCCTGTGACCCTGGGGGCTGTGCCA
GCTCCACAGGCTCCACCCCCGCCCCCCAAGGCCCTGTACCCAGGTGCTCTGGGCCGGCCC
CCACCCATGCCCCCAATGAACTTTGATCCCCGATGGATGATGATTCCTCCTTATGTGGAC
CCCCGGCTCCTCCAGGGTCGTCCCCCTCTAGACTTCTACCCTCCTGGTGTGCATCCCTCT
GGTAAGGGGGCATGGGAGGAGTGAGAAACAGGAAAGTCCCCTCAGTCTTAGGAATTGGAT
ATCAGGGTCTTACTGTGACTCTGGTACGATAGGTTTTGCCCATCATAGTGATGAGGGAAG
GGCATATGCTTAGCACTGCTGAGATAGCTCTGTTGCAAAAATGGGCTTAGTTAAGAAATA
AGCAGTGGTTGGCCAGGCATTGTGGCTCACGCCTGTAATCCCAGCACTTAGGGAGGCCGA
GGTGGGCAGATCAACTGAGTTCAGGAGTTCGAGACCACCATGGCTAACGTGGTGAAACCC
CATTTCTACTAAAAATACAAAAAATCAGCGGGCGTGGTGGCGCTCGCCTGTAGTCCCAGC
TACTCGGGAGACTGAGGCAGGAGAAACGCTTGAACCCAGGAGGTGGAGGTTGTAGTGAGC
CGAGATTGTGCCATTGCACTCCAGCTTAGGCAACGAGCGAAACTCCGTCTCAAAAATGAA
TGAATGAATAGCAGAACTCCATCTCAAAAATGAATGAATGAATGAAAGAAGCAGTGGTCC
TTCATTTGCCAGGATTTATTTGGGGTGGGTTGATTCTCTTGTAGGGAATCTGAGTGGATA
ACCTTGTCATATAAGAGCAGGCAAGGCCCGGACCTACTGGGAACAAGAGATGGAAGAGCT
GACTTGACAGGGAGGGGAGATGCTTTTTGGGCTGGAGGGCTTGTGACATGAATAGGATTA
TTTTTCTTTTTCTTTGGTTTCTTCAGGCCTAGTTCCCCGAGAGCGTTCAGACAGTGGGGG
CTCAAGCTCAGAGCCATTTGACCGTCATGCACCTGCTATGTTACGGGAACGGGGCACTCC
ACCGGTGGATCCAAAGTTGGCCTGGGTAGGAGATGTCTTCACCGCCACACCCGCTGACCC
CCGCCCACTTACCTCACCTCTGCGCCAGGCTGCGGATGAGGATGACAAGGGGATGAGGTG
AGTCTTGGTCATGAGAAATGGGTGAGTTCACAGTGAAAGGATCTAGGCCTGGGAGAAAGG
TACTTTGGGTTAGTGGTAGGGATAGGGATGAACGGGAAAGGAGAGGCTGGATGCAGTGGC
TCATGCCTGTAATCCCAGCATTTTGGGAGGCTGAGGCAAGAAGATTGCTTGAGCCCAGCA
GTTCGAGACTAGCCTGGGCAACTGGATACCATCTCTGCCAAAACAAACAGAAAAATAGTA
AAAGAGAGTCTACATCATAATAAAGTGTTCTTTTTCCACCTAGTTCTGGTTTTCCTGAGA
TACTTATTTCCATTCTTTCTGTCTGTCTCTTCAGGAGCGAGACTCCTCCAGTACCTCCCC
CACCACCCTATCTGGCCAGTTATCCAGGCTTTCCTGAGAATGGAGCCCCTGGGCCCCCAA
TCTCTCGCTTTCCTCTGGAGGAACCAGGGCCCCATCCACTCCCCTGGCCCCCAGGCAGTG
ATGAAGTGGCCAAGATACAAACTCCACCACCCAAGAAGGAGCCCCCTAAGGAGGAGACTG
CACAGCTGACGGGGCCAGAAGCAGGCCGAAAGCCTGCCCGCGGAGTCGGGAGTGGAGGCC
AGGGCCCCCCACCACCACGCAGAGAGAGTCGCACAGAGACCCGCTGGGGCCCTCGTCCAG
GCAGCAGTCGTCGTGGAATCCCTCCAGAGGAGCCAGGGGCCCCACCCCGCCGGGCTGGGC
CTATAAAGAAACCTCCACCACCTACAAAAGTCGAAGAGCTGCCTCCCAAGCCCCTCGAAC
AGGGGGATGAAACCCCCAAAGCCCCAAAGCCAGACCCACTCAAGATAACCAAGGGGAAGC
TAGGGGGCCCCAAGGAGACCCCACCCAATGGGAATCTTTCCCCTGCCCCAAGGCTTCGGA
GGGACTATTCGTATGAAAGAGTGGGTCCTACCTCTTGCCGGGGTCGGGGCCGAGGCGAGT
ATTTTGCCAGAGGGAGGGGTTTTCGGGGGACCTATGGGGGACGAGGGCGGGGAGCCCGAA
GCCGGGAATTCCGCAGTTATCGAGAGTTTCGAGGAGATGATGGGCGTGGAGGTGGGACAG
GGGGACCAAACCACCCTCCTGCTCCCCGAGGCCGCACTGCCAGTGAGACACGGAGCGAGG
GTTCAGAGTACGAGGAAATCCCCAAGCGGCGCCGGCAGCGGGGCTCAGAAACAGGCAGCG
AGACCCATGAGAGTGATCTGGCTCCTTCAGACAAGGAGGCTCCCACACCCAAGGAGGGAA
CACTCACCCAGGTCCCTCTCGCTCCCCCACCACCAGGAGCCCCACCTTCACCAGCCCCAG
CCCGCTTCACTGCCCGGGGTGGGCGAGTCTTCACTCCCAGAGGGGTGCCATCTCGCCGGG
GCCGAGGAGGAGGGAGGCCCCCTCCTCAAGTTTGCCCAGGCTGGAGCCCTCCAGCCAAGT
CTCTGGCTCCCAAGAAACCTCCCACAGGCCCTTTGCCACCAAGTAAGGAGCCTTTGAAAG
AGAAGTTGATCCCAGGGCCTCTGTCCCCCGTGGCGCGCGGAGGCAGCAGCGGAGGTAGCA
ATGTGGGCATGGAAGATGGGGAGCGACCCCGAAGGAGGCGACATGGGAGGGCTCAGCAGC
AGGATAAACCGCCTCGTTTCCGGAGGCTGAAGCAGGAACGGGAGAATGCCGCAAGGGGGT
CTGAGGGCAAGCCATCCCTAACCCTTCCAGCCTCCGCTCCTGGACCTGAGGAGGCCCTCA
CAACAGTCACAGTGGCCCCAGCACCTCGCCGGGCAGCTGCCAAGTCTCCTGATCTGTCAA
ACCAGAACTCGGACCAAGCCAATGAGGAATGGGAGACTGCATCAGAGAGCAGTGACTTCG
CCAGTGAGCGCCGAGGGGACAAAGAGGCACCCCCACCAGTACTGCTGACACCCAAGGCTA
TGGGAACTCCTGGGGGAGGTGGAGGTGGAGCCGTACCAGGTATTTCAGCCATGTCCCGCG
GAGATCTGAGCCAGAGAGCCAAGGATTTGAGTAAACGGAGCTTCTCAAGTCAGCGGCCAG
GCATGGAACGGCAGAATCGGCGCCCTGGCCCAGGGGGCAAGGCTGGCAGCAGTGGCAGCA
GCAGTGGAGGAGGCGGTGGGGGTCCTGGAGGAAGGACCGGGCCAGGACGAGGTGACAAGA
GGAGCTGGCCCTCTCCCAAGAACCGAAGGTGGGTAGGAACAAACAAATTTATTGTGGTTT
AAAAATTGGAGGAGGGGGAAAAAGCCTGAGGGAAAGATAAGTTTGGGTGGAGTGGAGATT
GTGGCCTGAGGGGCCATGAGCTCTAGAATGTCAGTAGGATTTCTATATCTGGCTAAGGCA
ACTGGAAAGCGGTTGGTAGGGTGTTACAGTCAAGAAGACCCACCTATGTATTTATTGCTG
GTTCTTTGCTTTCCAGTCTGTGCGTCTGTACACATAGGAACCCTTAGAAGGACTCAAAAA
CACCTGGACTTTAATAGGGAAGAGAATAGGTTGTAAGCAGAAGTTGGGAAACATAACTTG
TGGGAAAAAGTAACGATTTAGTGGATACTGGAGCTAATGCTCTGTTTTCTCCAGTCGTCC
TCCAGAGGAGCGTCCCCCGGGGCTTCCCCTGCCTCCCCCACCTCCCAGCAGTTCTGCTGT
CTTCCGCCTGGACCAAGTTATCCACAGCAACCCTGCTGGCATCCAACAGGCTCTGGCCCA
GCTTAGTAGCCGTCAAGGGAGTGTAACTGCACCAGGGGGTCACCCAAGGCACAAGCCTGG
GCCTCCCCAAGCCCCTCAGGGCCCCTCTCCTAGGCCCCCAACCCGATATGAGCCCCAGAG
GGTCAACAGCGGCCTCAGTTCTGGTAAGCTGGAGGGGTTATGGGTGGGAATATCTCCATC
CCCAGAGAAGGTCAAGTGCTGGAGGGAGCGGGTGGAGAACCTGGCCTAGGGGCCCTGCTG
CTGGGTGCGTTTCTGCAGGGAGCAAGGGTAGAAGAATTGGGAGGTGGAGTAGAGAGGAAA
AGTTAGGGTCAGTGGCAGAGCCAGGCAGATGCTGACCCTTTTTCTCTTTCCCAGACCCCC
ACTTTGAGGAGCCGGGGCCAATGGTGAGAGGGGTGGGTGGGACTCCTCGGGACTCTGCCG
GGGTTAGTCCCTTTCCCCCTAAACGTCGGGAGCGGCCTCCCAGAAAACCAGAGCTGCTAC
AGGAGGTAAGGGATGGGTTTGAGATTGTGCTTCACTGCACTCTTACTCGTGAAAATTCTT
CTGGGTTATGTTTTCTCTGTTCTCTTCCCTGTTTCTTTCACTGTGTTTTTACTCCAGAAT
TCTCAGTATTAGTCTCCCATGTGTCTCCCTTGTTGTCCCCACACCCTGTGTCACCCCACT
CTGTCCTGGCTTCCTATAATTCCCAATTCCCACCCAATTCATGTTTTGCTTCTGGCCCTT
CTCATCTGTAGGAATCTTTGCCACCTCCTCATAGCTCTGGATTCTTGGGCTCTAAGCCTG
AGGGCCCAGGCCCTCAGGCAGAGTCCAGAGATACAGGCACAGAGGCCCTGACCCCTCACA
TCTGGAACCGTTTACATACTGGTGAGTAAAGCTGAGTGAAAGGACTATGGTAGAAGGGTT
AAGAATGAGAGGGGCTTCTGAACTGTCATCTCCTCACTTCTCTTCTGGTTGGTGCTCCCT
TCTCCAGCCACTAGCCGAAAGAGTTACCGGCCCAGCTCCATGGAGCCTTGGATGGAGCCC
CTGAGTCCTTTTGAGGATGTGGCTGGCACAGAAGTGAGTGAGGGTGGGAGGGTGTGTCTG
AGCTGGGACTTTTTTGAGCACTGGTCATACTCCCCCACCTGCTCTGGGTTGAGTCTGGAG
CTGTTCTCTCACTTGGCTGTCCCTTTTCTGCAGTTTGTATGTGTGCATCAGTCAGGTATT
GGGGTGCTTTCTACCCTGACTTAACTAGCTCCTTCTCCACTCCTCTCAGATGAGTCAGTC
TGACAGTGGGGTGGACCTGAGTGGGGATTCTCAGGTGTCATCAGGTCCCTGCAGCCAGCG
AAGTTCCCCTGATGGAGGACTCAAGGGGGCAGCAGAGGGACCCCCCAAGAGGCCTGGAGG
CTCCTCACCCCTGAATGCTGTTCCTTGTGAGGGTCCACCTGGCTCTGAACCTCCTAGGAG
ACCACCACCTGCCCCCAACGATGGGGACAGAAAGGTAAAAGACCAAAAAAGGATAAGGGG
AATGTTTCCAGGAATCTGACTTTGGCCCTACCTTTTTCTGCTTTTTCTCTGTGTGTGTGT
GTTCTGGGCATTCCAATTTGGATTTCCCTTTCCCTCCCCCAATGCACTTTACTGTGTGCC
CAATCCAGGAGCTGCCCCAGGAGCAGCCTCTGCCCCCTGGCCCCATTGGCACAGAACGAT
CACAGCGTACAGACCGAGGCACAGAGCCTGGCCCCATTCGGCCATCCCATCGACCTGGTC
CCCCAGTCCAGTTTGGCACTAGTGACAAGGTCTGTGTGGGCTGGATCTGGGTATCCTGAG
TTGGGTGGAGAGAAGGGAAGGACTAAAGGTGGGACATAGAGGACACATGTCTGTCACGGG
ACAATGTCTCCTGCTTTCTTGTGATCACAGGACTCAGACTTACGCCTAGTGGTAGGAGAC
AGCTTGAAAGCAGAGAAGGAGCTAACAGCATCAGTCACTGAGGTAAGTGGGAGTAAGAGT
TTGGTGGAAAGGCCCAAGATTTCCGGGGAAGATTGCTGGGAGTGACCAGGGCGTCCAGGA
TGCCAGACATCCCTCTCCACGAGGCCTCTCCTTCCCAGGCCATTCCTGTATCACGAGACT
GGGAGCTGCTTCCCAGTGCTGCTGCCTCTGCTGAGCCACAATCCAAGAACCTGGGTTCTG
GGCACTGTGGCCCAGAGCCCAGCTCCTCAGGCCAGCGCCTGTATCCTGAGGTTTTCTATG
GCAGTGCTGGGCCTTCCAGTTCTCAGGTAGGCCCTGCTTCCCATTGCATGACCCCTTCAG
TGAATAATAATTTTTTTCTGCCTGGTATGTATTTATAATCAAGCCTTTCTACGTTGCAGA
GTTGTGAGATACCACTTTGTCACATCATTTTTCTCCCTACTTTTTGCTTCTATGGGTGGG
ATGGTGATCTTTTTTCTTGACCACAGATACTAAAGCTGTTTCAACTGTGCTCCTCTCCTG
CAGATCTCTGGGGGAGCCATGGACTCTCAATTACATCCAAACAGTGGAGGCTTCCGCCCT
GGGACACCCTCACTGCACCCTTACAGGTAAGACTCGATGCCTGTGGATCACAGAAGTACT
TGGAGATGTGTTTCGGGGAGAGGGAAGGGGAAGACACAGTTCTAGGGTACTAGAAGCTAG
TGGACTTAAGGCATTGCTAGGACTCTGGCTTCCTAACAGCTTTTCTCCCCACAATTTATT
TTCAGATCACAGCCCCTATACCTACCCCCCGGCCCAGCCCCTCCCTCAGCACTGCTCTCT
GGGGTAGCTCTCAAGGGCCAGTTTCTGGATTTCTCCACACTGCAAGCTACAGAGCTGGGG
AAGTTGCCGGCTGGAGGAGTTCTCTACCCTCCACCTTCCTTCCTCTACTCTCCGGCTTTC
TGCCCCAGTCCTTTGCCTGACACATCGTTGCTTCAGGTAAGAGGGGGGCAGGTATTAGAT
ATTGGGGGATAGGGTGGGGAGAATGATTTTGTGGGGGTTGATATATTTCTCCCTGTTTCC
CTACAGGTACGCCAGGATCTGCCATCCCCTTCGGATTTTTATTCTACTCCTCTGCAGCCT
GGTGGCCAAAGTGGCTTTCTCCCTTCAGGGGCTCCTGCCCAGCAGGTATATTGTATCTTC
ACACTTCCCCTTCATTTGATTTCTCTGTCCAGTTGCTGGCTTTGATTTTCCCTGGTTTTC
TGACATTCCTCCCTGCCCCCAACATGCACACCCAAATTTCTTGTTACAGATGCTTCTACC
CATGGTAGACTCACAGCTGCCTGTGGTGAACTTTGGCTCCCTGCCGCCAGCACCACCTCC
TGCCCCACCTCCCCTTTCTCTGTTACCTGTGGGCCCTGCTCTGCAGCCCCCCAGCCTGGC
TGTGCGGCCCCCACCTGCTCCTGCTACTCGGGTGCTGCCTTCACCTGCCAGGCCCTTCCC
CGCTAGCTTGGGGCGAGCAGAGGTAAGGTACAGGAACTGAGGGACTAGGGAGCGCCAAGA
CTTAGGAGTAGGGATTCTGTATTTCAAGGTAGGCAGCTCATGATTTTTTTTCCCTCAGCT
GCATCCAGTGGAACTAAAGCCGTTCCAGGATTATCAAAAACTGAGCAGCAACCTTGGGGG
ACCTGGATCATCACGGACTCCCCCAGCTGGAAGGTGAAACGGAATAGGGATGTGGACTTT
CCAAGTGCTTCCTTACTTTGGAACCAGGGTCTGGATCCTAGGCTTGCCTTAGACGCCCTT
CTTCCCTTAGGTCCTTCTCTGGCCTCAATTCGCGTCTCAAGGCCACGCCTTCCACCTACA
GTGGAGTCTTCCGCACCCAGCGCGTCGACCTTTACCAGCAGGTGAAGGAGAAACCCTTGT
GGCCCCAACTCTAAATTCGAGTTGCCACCTGATTTCCTGTCCTTCCGTCTCATCGCTGAC
CTCTCACTGTGACTCACTCTTTAACACATGCCTGTCCCCTAGGCCTCCCCACCAGATGCC
CTGCGCTGGATACCTAAGCCTTGGGAGCGGACAGGGCCGCCACCTCGAGAAGGGCCCTCC
CGACGGGCAGAGGAGCCTGGGTCCCGAGGGGACAAGGAGCCTGGGTTGCCCCCACCCCGC
TGAGGGAGTTCCTCTTGCCCCCTACCCCCGGGGCTTGTATATAGATTATAAATATATAAG
GGGGAAAGGGGTGGGCGGGGAGGGGTTGTGGGGCTGGGGCCTCACTTCCCCTCCTCCCCC
TTCCCCTGGTCCCCTGTCCCTGGGGCTGTTTGTTAAAAAAGAGTAATAAAAGGATTTAAA
AAAAAACTTCTACAATGATTTGGGGGATGGGTTGTTTGCATTGTCTTAAAGCATGGTGCT
GAGTGATCTGTAGTTTCAGTCAGGGAAATATTCATTACTTATTCCAGTGAGCTGTTGAAA
CTAAAAACATGACCATCGTATTGGATCTTTAAATTTTTGAGAGTCGGGAATTTGGGCTGA
GCTCAGCTGGATAAATCTGCTTTTTTGTGCCAGTGAGCGAGGTCAACTGGTTATCAGTCT
GCAGCTGACACCTGGGCTGGTCCCAATATGGCTTCCTTTGCATATCTGGGGCCTTGGTGG
GACATCTGTAACATTACTGGATTATCAACCAGTGTCTTCACATGGACTCTTCAGCAGGCC
TGTTAAATGTCCGTGAGCTCATGTTCCAAGAGGTCTAGCTGGAATTTTCTAAGCTTATGC
CATGCTTAGTTGATAGAGCACTAAACTAGCCAAGGTAGGCGATGGGGGGGTTTAGAAGGG
ACTTCAACTGCATCTCAAAGGGACTAGCAAAGAATTTGCAGCCATGGGACTTCAGTCCTT
TATGATGAACTAAGGGGAAATCTCTGTTAAGGCCTCAATGTTGGAGCACACTTAAGGGGC
TCTTTGAATTGGATAGACCCAATTCCAGCATTGTCAAACTAAGTGGGATTTCACATGGTA
ACGCTGCATGCTAGTTATGCTAAAGACTATACTTAGGTCTGCAGCTGCTCAGAAACTTTT
TTTGATGGGTAATTTGAGAGCTCTATCCTAGTGTGCACCTGGAATATGCTCCCAACTCAA
AATACAGGTTTTTTATTTATATATAAAGTGCTTTCGCACAAAAAATACAAACATCAGGCT
GGGCGCGGTGGCCCACGCCTGTAATTCCAGCACTTTGGGAGGCCAAGGTGGGTGGATCAC
AAGGTCAGGAGTTCGAGACCAGCCTGGCCAATGTGGTGAAACCCTCTCTCTACTAAAAAT
ACAAAAATTAGCCGGGCGTGGTGGCAGACGCCTGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1186, 3075..3249, 4082..4259, 4613..4712, 4802..4874, 5527..5670, 5816..5967, 6148..6227, 6376..6518, 7130..7220, 7341..7557, 8125..8599, 9504..9694, 10263..10560, 11306..11516, 11854..13707, 14094..14362, 14574..14704, 14951..15080, 15187..15272, 15469..15693, 15848..15988, 16110..16181, 16298..16465, 16683..16765, 16925..17135, 17226..17324, 17449..17661, 17758..17852, 17950..18040, 18162..18476
3138..3249, 4082..4259, 4613..4712, 4802..4874, 5527..5670, 5816..5967, 6148..6227, 6376..6518, 7130..7220, 7341..7557, 8125..8599, 9504..9694, 10263..10560, 11306..11516, 11854..13707, 14094..14362, 14574..14704, 14951..15080, 15187..15272, 15469..15693, 15848..15988, 16110..16181, 16298..16465, 16683..16765, 16925..17135, 17226..17324, 17449..17661, 17758..17852, 17950..18040, 18162..18299
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved