Pan_troglodytes Locus Mono:91:SNORA42
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:91:SNORA42
Pan_troglodytes
Mono:91:SNORA42
14
SNORA42
1001..1139
2139
AGAAGAATAAAATGGGAGAAATCAGTTTAGCTGACTTCCTGACTTACTATATTACAGTC
ATTAAGATGGTGTGGTCTTGGTGGATGGACAGGCCTATAGATCAGTGGGACAGAGTAGAA
AATGCACAAATGGACTCCTACAGATATGCACAACTGATTTTTTATAAAAATGCAAAAATT
ATTCAATGGTGTAGGATAGTCTTTTCAAACAATTGCTGCTCAATCAATTGTACATCCCTT
AGCCAGAAAAAGAACCCTGACCTAAGTCTTGCATCCTATAAAAAATGTACTTAAAATAAT
AATTCATAGACACATGTAAAATATAAAACTATTAAACTTGTAGAAAAAAAAGGATATCTT
TGGGATTTAGGGCTAGGGAAAGCATTCTTACACTTGACCCCAAAAGCACTATTTGTAAAA
GGAAAAATAGATAAATTGGACTTCATCAGAATTAATTTTTTTTCTCTACAAAAGACCCTG
TTAAGAGGATTAAATACAAGCCACTGACTCGGAGAAAATATTTTGCAAAACACGAATCCA
GTAAAGAATTAGTATCTAGCATACATAATGAATTTTCAAAACACAATATAAAAATATCTA
ACTGGAAAGTGGGCAAAACCATTAATAAACATTTCACCACATAGGATATATAGATGGCAA
AGAAGCATATGAAAAGATGCGCAACATCATTAGCTATTAGGGAAATGCAAATTAAAACCA
CCATAAGATATTACTACAGAATGGTTAAAATAAAATAATAGTGATAACACCAAATGCCAA
TAAGGAAGTGGAGGAGAAATAGGATCATTGTTTTTGGGAAGGTAAAATGGTACAGCCCTC
TAGAAAGCAGTTTGGTAATTAGAAAAAAACCCAAAGTATGCATGCAGTTCTGTAAGATAA
AGTGTCTGTCCAGGCATGCATACAACCCAGCAATTGCATGCCTGGGCGCTTACCTTACAG
AAATGAACATTTATAATTACATTATAATTTGTACACAAAATTCATCACAGCTTTATTAAG
AGAAGCCAAACTCTCTGTGGGCTTCTCACAGTGTACCCATGCCAGAGTAAACTGCAGCCT
TGAACCATTGCTCAGCCTCCTTACCCGTGAGCTATGAACACTGAAGCAGGTTGCACAGTG
AAAAAAAAAAACAAAAACCTCAAACAGGAAACACTCTGGATAACCTTCAGTGGGTTAAGA
AAACTGTGGTACATCCATAGATGGAATACTAATCACCAATAAAAAGGAATGAACTATTCA
TACATGTGATAACAATGAATCTTAAGAGAATTGGGCTGAAAAATCCAATTCTGAAAGATT
ACATACTGTGTAATTTCATTATATAACTTCCTCAAAATGACAAAATTATACAAATAAAGA
ATAGAATAGTGGTTTCCAGGTTTTCAGGATGGGGGTTAGGATGAGTATGACTTTAAAGGA
CAAGATGGATCCCTTGTGATGATGGAAATGTTTTGTAGCTTGACTGTTTCATGTCAACAT
GTTGTTTATGATATGGTACTATGGTTTTGCATGATGTTGTCTTTGGGCTAAACTGGATAA
AGGGAAGATGGGATATCTTTGTATTATTTCTTAAAACTGCCTGTGAATCTACAATTATCT
CAAAATAAAAAGCCTAATAAAGAAATTGTGGTCAGTGGAACAGAAAAAAAAAAAAAGAAA
AATAAGAAAAAAAATGTAGCCTCAGTTAAAAAGATAATTGTTACATGATGATTTGTACAA
TAAAAAAGCTTGTTGCAATTGAAATCTGAAACTGTATTGATGACTTTCATACTTTATTAT
GTTAAAATCTATTGTTTTATCTTGTACTTTGAATGGCTGTTTTACTCATGGATTATTTCA
AATAACATCACACGTTGGTTATTTGGAAAATACTGTTCAGTTATTTAACTCTTCAAATGT
TGACACATTTCAGCTTATTTTTAAAATTGTCAGAAAAGTTCTTTAGCATTGGGAACCTTG
CAAACTCATGGTAAGGGACACATGTTTTCCAAAATTCTAATTTTTGTTGAAAAGCTCAAT
TTTTTTCATTGTCACAAATACACTCGGGTGTTTTATTTGAAGTGACCAGTTTGCTTCATC
CCTTTTCAAGAAAAATCTTGCCGTATACCCAACTCTCAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved