Pan_troglodytes Locus Mono:226:SNORA62
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:226:SNORA62
Pan_troglodytes
Mono:226:SNORA62
11
SNORA62
1001..1153
2153
ACAATTTCCCCTCCGATTTTAAGCCTGCAAAGAAATATACAGTGTTGGTTGAATGTTAT
CTGTAGGCTGCTAGAAACTGGAAATTATGCCAGAAACTGCATTCCACATAATAATGCTTA
TTGGGATAGCAACCATGAGCAAGCCCCATACATAGCTTTTAAGAAAAAAAATAAAAACTG
AAGATATCTTGTTTTGCACTAGAGAGTATATAAAGAAAAAAAATACTAGCATGAATCTTT
AAAATATTTCATTAATAAAGGAACAACATCTGGAAAATCCAGAGCATGAGCATATATGAA
GAAATGTAATAATGTCTGTAAACCATGTAGCATGTTGCCTATCACATCACAATGACTCAG
TTATCAGTATCTCAAATGTAAAAACTTCTGCAGAGCTAACAAGAAAACATCCTTAAGGTA
ATGTAGGTAATAGCATCATATAGCATTATGGAAAAACAAAGAACACATTGGAAAAATGTC
AAAATAATAAAATACTAAAAAATAGAATTAAAGTGCACATTGAACATAATCAAAAACAGC
GTCAAGGGACAGTAATTAACTTAGTTCAATTTGGAGAATGCATTTCAAAAATTCTCTCAT
AATGCATAGAAAAAATACGGTGAAAATAAAATAATGAGAAAATTATATTTGGGAAGGGCA
CAGAATGAAAAGCCAACATACAAATAACTATAGTCTCAGGTACAGTAAACAAAAATAAAT
ACAATAAAAATGACTGTTCCAAAGGAAAGACTCCAGTGTATTGACGATGAAAGGGCTCAT
TGTATTCAAGGTAAAATCAGGAAGATAAGAACAAGCATAAAATATTTGACTTAAATAAGT
TTTTTTTTTAAATTACAAGCTTTCAGGCAGAAAATATGGATTTCCTATAAAGAAATGGAA
ATTAAGCCGGTTTTACAAAAAAATTAAAATATTTTAAAAGTCCTTTATAAAACATGCCAT
TCATGACGCAGAAAGAATAAAATATGTGAAAACAGATGGAGATTGCACGTTGTTGGAGCT
TGGAGTTGGTGCTCTAACTGGCTGATAAACTTGCAAGTGTAGGTAGTATGCTACGTGAGG
GGCAAATTTTTCAGTAACATGACAAAGGTCTTTGGCCTAGTGAGTAGAGTTTGACAATAA
TCCTCGCTGCAAGTATAATGTTAAAAAAATTACAAAAAAAAAAAAAAACTAAGACACTGA
CGACTACAAAGCTTTGCTGAGAGATATTTTAAAAGATGTAAATAAGTGAAGAGATATCAC
ATGTAAATGGATTAGAAGACTCAATAGCATAGACATGGCTGTTTTCCCTTAATGGATCTA
TAAATTTAATGTAAAATCAACAAGTCTTTTTTTTTCTGTAAAAACTGACACTCATTCTAC
AATTTATATGGAAATGCAAAAGACTTACAATTTTGAAATAGAAGAAACAACCTGGATTGA
AAACTTAACATTAAACCAATGCAATTAAGACACATAGCATGAGGACAGTCATACAGATTA
ATAGGACAAATTGGAGAGTCCAGATTTAAACACCTACATTATAGCCAATTGGTTTGTAAT
AAAGGTGTCAAGACAATTAAATGAGAGAAAGGATAGACTTTCCAATAAATGGTGCTAGAA
CAATTAAATATCACTATGAAAAAAAATAAATAACTTGGATTCTTAGCAAGCACTGTCCTA
AAAAACTAGCTCAAAATGGATTACAGACCTAAATGTAAGAGCTAAAAATCAGAAACTTCT
AGAAAAAAAATCGGAGAAGATTTTATGACCTTGGGTTAGGCAAAACATTATTAGATACCA
TATTAAAAGTGTGAGCCATTAAATAAATGATCAATATCAGACTTCAAACAAAAAAAAGTA
TAATTTAAAAGTCACCATTAAGAAAATAAGAATAGAGAAAACAGACTGGGAGAAAATATT
TGCATAAAAAACTCATATACAAAAAATGTAAAGAACTCAATAAAGAGACAAACAATCCAA
TTAAAAATGGGCAAAATATTTGAATACACATATCACCAAAACATATATAAAAATGACTAA
CAAGCCCACGAAAGATGAGAATTAGGGAAGTAAAATTAAAATTAAGAAATAAAAATTTAA
ACTGCTATAAAATACCTTTATCCACCCACTAGAATGGCTATAAATGAGAAACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved