Pan_troglodytes Locus Mono:227:SNORA1
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:227:SNORA1
Pan_troglodytes
Mono:227:SNORA1
11
SNORA1
1001..1136
2136
AACCTGATCATTAAGCGGTGGGAGTGCTTAAACAACAGTGACAAGCCCAAGGTGGCTGA
AGCAGCTGGTATGTTACCAGAGGAAGATGCAGATGAAGGACAAGCAGAGGATAGTCAATG
AAGATAGGCGCTGAATGAGCAACAAATCAATATTGAATCAATCAAAGGGATGAATATGGG
TGCCTCTATGTGGCCTGCTTCAAGCTAGATTCAATGATGATCCAAACATATGTGGATGCT
GGCCATGCAGATGTTATTCTGGGAGGGAAGATCAATAAGTGTGAGGGGGTCAGGACTTAA
CTGTAGATTGGGCTTGTATCCTTAGCTTTTGCTCATTGTGGCCTCCATAGCCTGCCTGGG
AAGCTGAATGGCCAATGTCTAAAGTGCATGTACAATTATGACAGCGTCCACAACAAGCAG
CCAGCCATCTGTATACGCTGAAAAGCCAGGCAGAACTCTGCTGTGGGTCTTGGGGTCCCA
GGAAGCAAAGAGATCTTCCATTTCAGGACCTCAAGATAAAGTTTCTCAAGGTCCTCCCAA
GGCTCAGCCCTAGCAGATCCTGAAGGCAAACCCCTACTTTTTGTGGGTTATAGGGTCCCA
CAATGGTTGTTCTGGACCGTGGAATTTTATCTTTCAAGTCCTGATCCCTATCACACTTAC
ACTAATTGATCTTTCCCCCTAGACAATAACATCCGCATGGTCAGGATCTACATCTGTTTG
GGACATCATTGAATCCAGTTTGAAGCAGTTCACATAGAGGTGCCCATATTCAGATCCCTT
TGATAGATCCAATATTGATTTGTTGGTCATCTGCTGTTCTCAGATTAGAGGTGAGGAAAT
AAGACAGTTCCTAAGTAGAGAAGAGACAACCATGGCACACTGCACACAGGGCAATGACGG
CGCCTGACCATCTAGACAAAAAAGAATGAGAAACTATCCTGGACCGTGACAAATGAAGGC
AGTCACATATGCATAGCTTATCCTAAGAACTGTGAAGGTGATGCCCCATTCTCAAAGAGA
ATAGGCACTGTTGATCATGCGATCCAGAGATTGTTAATGGGGCTACATTGAGAAACAAGC
TATGTTTCCATTCACAGCAAACACATCACAGTGGTGACAATGAGACCTGTAACATTTCTG
CTAAGGTCACGAGTGAAAATGGGATGCAACACAACCTCAACATTAGAAAAATGTTAAAGA
ATAATGCATTTTTGCTCATTAGCCAAAATAGCAATATGCTTTCTACAATTCAACTGCTAG
GGCCCTAAAGTGAATTATTTGAAGAATTAGACCCTAAAGATTCTGGATAGGAAGTTTTTA
AAGTATTTCATCAGTATGTCTGTATTGAAGTGGAGACAAAAGAAGCCCAACTAAGATGGA
CAGAAGGACTGTGGATTCAGCAAGAATCTCTAGAAAGGCCTATCTTGAAGATAAATCTTG
ACTCAAGATTTGGAGGAACTAAGATGACCCTGATGGGCAGTAGAACGAATCACAACATGT
AAAATTCCTTAAATAAAAATGTATTGACTTAAAGAAAAAACCATAATGGTGGTATTTGGT
TGTTTGTGAGCTTTTGCAGTCAGGATTGTTGCTCAAATACCTTCCTCACTTCTCCATATC
TGCCTTGGTTTGCCTTTATCACACTGTCCCCCAGGGCCTGGCTCAGTTGATGCTTTTGGA
AAATGGATTTTGAGCTGTAAAAGACAGCTTTTCCAGATATAAACTCAAGCTTCTGAAGCA
AGAATTGGATTAAAAGGAGCAACCGAAAAGGACCTCAGAGATCCTCTGGGACAATTGCTT
TTAATCTGGGTTTCCTGGAGCTTAAAGGTTCTGCAGAGGTGCCTGGGGTGCGGGGAGCTG
GGAGGCAGTCCTGGGTAAGGGGGATGCTAAAGTGGCAAGACTCAGGGTCTCCACCTTCCA
GCCAGAAGAGCTCAATGTGACCTTTTTCACCCACTGAAGTTCCAAATCTGTTAGGAGAAA
GATTCCAAGGTTTAAGGTTTTAAACCCACTAAGCTAGTCCAACACCATCATCATATCATA
ATTTTAAAAATAGCTGATTTTGAGTGTTTAGTGTGTGCCAGGAACCGTTATAAATGCTTT
ACATGCATTACCTCATCTAATCCTCGCAGCAGCTCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved