Pan_troglodytes Locus Poly:12:SNORND104
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Poly:12:SNORND104
Pan_troglodytes
Poly:12:SNORND104
17
SNORA76
1273..1405
2405
GGAAAAGAATTCCCAAGGAAAACAGGGAGGCAATAAAGATAACCGGCGACTGTGACTGC
TGGTGTACTGTGTCCTCCCCCAGTTAAGCAAACTCTCATTCATCCACCTGTATGTCCGGG
GAATAGGCTCAATCAACTCTGCGAAGCTTTCCCAAAGTCAGGCTTTCTGTCCTTTGGGCT
TCTACGGTAGGCTGTTCATAGCGCTATGTTAGTATTTATTAAAGTTTTGCAATCCCAGGA
AGTTTTTCACATCACTCTGCCCTTTAAATACCTTTGTTTACCACTTAGAATGTGCCAGGC
AATTGGCATTAATTCACCGAATCCTTACATTTTTTTTTTCCCGGTGTGTGTGTGGGTGGG
TGGGGGGGGGGGGGTATTCCTAATTTCCAGAAACTGAATCTCAGAAAGGTTAACTGAGCA
AGGTCACAGAGCGAATGCATCACAAAGTCAGGATGTGGTGCAGATCGGTCCATTTTCAAT
ACAAGCTCTTTCTACCACGAGAGGTTATTTTGCACTTGGGGACAGTTTTTAACTTTCCAT
TCTCAACTCCTATCCTAGCTCCTGGCACAGAACATGTCATCCAAGTTAGGCATCATCGTC
GCCTGCTCTTGGTGAAGTTTTCTTTTGCGTACTGCGGAGAGATGCGCTCATTACCAGCTG
GCGATGGAGACGCTGAAACGCAAATGGATTTGAGACTGAGCGACTCCCATCTCTATGGTT
GGTATGTGACCCATCTATCCTCTGGAGGACTCAGCAAGGACTACCAGTCACCAGACAACT
TTACGCGCACGTGGTCGCAAGGTGAACTTGCTATTGGTTAATGGCAGTAAAGCCCTCCCA
TCAGCGCTGGTCTGCTCCTTTAAAAGAACGCCATCGACGCTCCCCTGTCTTTCAGCGCCT
GCAGGTTCCGGGAGGTGAGGTTGTATTCCTGGCGGGTTGTCTGCCTGGGTGGGTCCCGGA
GGTCGTGGCCCGGGAGCAGGGAGGCGTAGGGGGGCCGGCTTGCTGTGATGACATTCCAAT
TAAAGCACGTGTTAGACTGCTGACGCGGGTGATGCGAACTGGAGTCTGAGCCTGCCCGAG
CGGAGCTGGGACGGGGCTGGCGGGCGGGCGGGCGCGCGCGCGCGCGCGCGCACACCCGCT
GATCTATCACTCTCGTTCTTGTAGCTCCCAGCCGAGGACGTCGGATGTCATCGTCCTTGC
TGCTTTGCCACCCCATTCCCGTCAATAAAGTGGTTTGAACCCAACCCTGGTGTCGGTGTG
TGTCGTTGGTGACGCGCTGTCTTTGAGCCCCCGCCGAGCCTCCTCGTGGCGCCGGGGGTC
AATCTGCAGCGCTAGAGCATGTGCTTGCGCATAACTGGGGCCGCCTGGCCCCCCGCGGGC
GGCCTTTTTAACCGCGAGCGACAAGAAGTAACCTGACTGTCCGGCTGCTAGGCTGGGCAA
TTTTCCAGCTGTTTTGCCACGACAGGCCTAAATCCGTAATACCAAGGCTGGAATGGCGTG
TTAGGGGGGCGGTGGCTGACGGGGATACGCGGACTCTGCTGCGTAAGGAGTGCCCCTCTG
CTCCCATAACGTTCCCCAGCCCAGCCCTCCCTGAGTGTATCGCGCGCGCTGTGCCTTCGC
CGTGAGTTCGACATAAGTTCCAAGCTGTCGCGTCTGCCATCAGACGCGCAGATTTAGTTG
AAGGCAGCGTGGAATGGCGTCTGCAGGGCTGTTGTGTACTTGACATAAACAGATTCGGTG
TGGAACTGCAGAGTTAACTCCTGACTAAAGGGTAATCGACCTGTTTACAAATAACCATGC
AGGAGTACTGACAAGCATGGGACTAAAGCTTTGGGCAGGTTAATCTGTCACTCCTAAACA
GTTCAAAATTATAGGGCGGTTGTGAAGGTGAATTAGATTTTATATATGGTTGGGGACAAC
ATAGACACCTAGTTACACAGTCCAGATTCAGTGATTGGTAAAAGATCTTCCACAAGGGCT
CCAGTGAAATGTGCATCAGTTCTGAGTACAGGGCAGCAATGGTGGGCAAGGATGCACGTA
TGCCTTCACTACATGGGCATTCGATGAATGAAGGTGTCCCGAATTAACATTATACTAGAC
AATGAAGGGTGTAAACTGCAGCCCAGGAGCACCACTGCCCTACCCCCTCAGTTACGAACT
TTCACTGGATTCTTTAAATGTGGGCTGAAGATAATGGCACATAGTTTGAAGGATGTAGTG
AGGATGGCTTTGTAGCCTTAGGACTGGGCAGTGATCAACCCAGTAAATGAAAGCTGCGAT
TGCCAGGTGAGGGCCCCGGTGCTCCGTACTCATTTTATTGTGCCCCTATCTGAACAGGAT
TCCGTAGAAATGACTTAGATGCTTATCTAGTATTTGACATGAGATATTTATTTTGTGAAA
CAATGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved