Pan_troglodytes Locus Poly:17:SNORD22
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Poly:17:SNORD22
Pan_troglodytes
Poly:17:SNORD22
11
SNORD25, SNORD26, SNORD27, SNORD28, SNORD29, SNORD30, SNORD31, SNORD22
1001..1069, 1267..1343, 1552..1623, 1943..2017, 2656..2720, 2891..2960, 3228..3298, 3588..3713
4713
ACCTAGCTCTTGGGATTTTGGTGGATTAATCGATTCATATAGTGTGCTTAAAACGGTGC
TCCATAAATGTTAGCTAATGTTGGCCCGTAGTAGTCCAAGATCTAAAGAAAACGCACCAG
AAGGCAGGACATAGGGAACCAGTTAGGAAAAAATCAGATCCTGTCTTCAGTGAAGCACTT
ACGTCCTGACTTACTTTCCCGAAATGGCCCCACCAAAGGGGACCTCCTCCCGAGCTTAGC
CCAGGATCCAGTACCTGAGTCGTCCCCCGCGCTGAGACCCTGGACACCAGCCTCCGAACG
TGAGCCAGGCAACTGGCGCGGAATCGACACGACGGCGATCGAGGCTTCAGGAAGCTGTAG
CTCCATGGAGGCGGATCCTGCACACAGGTTTGGGGTGTGTGTGGGCAAGGGGCAGCTCAG
AACAGGGTTAGAGGGTAGGCAGTCGTGACCGTCAGTCCAGGATCGCCGTGAGGCAGTGAT
CTCACCGCTCCTGCCACATGCACTGGGTGAGAAAACCAAGCCGCAATGCGGTCGGTGAGC
CAGCACGCTCCCGTAGGACGCATGCGCGCCTTTTTCGCGCCGCAAGTTCAGGTGGCGCTT
TGTCTACGCCCTCCTTCCCTGGAACTCTCTACCCACAACTCCCCGGGGTCGCATGCGGTC
AACGTATGCGCGTGCGCTCGCCATAGCCCCGCCCCCAAATCCCGTGGGCCTCTGCGGCAT
GGTATTTAATCGTGTCCCCGGGGGAGATTCGTTCTCATTTTTCTACTGCTCTTGGTAAGT
GGCCTCGTGGGCTTTATAGCTGTTACTCTTTTGTGCTTTGTCTTTTTATTTTCTTTTGAG
CGATTGTGCGAACATAGCATAGCACGCACTATGCCTTCTGTGTTGTAGCTGTCTGGCCAG
GGCGACTGGCGGATAAGGTCTTGTGTGTGGCCTCGAGGCTTAAAAGTAGCAGCGGGGCTT
TGTGAAGGACAAAATGGCGATGGCGGGCCGTGTAGGTCCCCCTTCCTATGATGAGGACCT
TTTCACAGACCTGTACTGAGCTCCGTGAGGATAAGTAACTCTGAGGAGATGGGCCCTGCA
AGCCTCCTGCTTAGCCGTCTCTTCAGAAAATAGCGTTTTCGAAATGCCTTGTGTTGACCT
AATGTCTTATTGGGCTCCTGTCTGCAGGATTTACGCGCACGTTGGAACCGAAGAGAGCTC
TGTTGTTGCAGTAAGTTCTTACGGCCATTTCTTAATCTCTGCTCTTTCGTTGAGTGTGTG
GAAGTTGCTACGGGGATGATTTTACGAACTGAACTCTCTCTTTCTGATGGATTAGTGGAG
AAAACACAGAAAATTCTGAGTAGCACTGTACTGTACGCAACAAATGTCAGGGCCCTATTG
ATTTGTCTGAGGTGTTAGTGAAGGGTGTTATTTTTTCAGATGTTCAGCCCACAAGACCTT
ACTGGTGAAGGAATGGGACAAGACCCATCTTTATGCAAAGCCAGCGTTACAGTAATGTCC
CAGGTAGGTGTACATGGTTTATGCTCTTACAGAGGAGACCTTGTAGATAACCACTCCATG
ATGAACACAAAATGACAAGCATATGGCTGAACTTTCAAGTGATGTCATCTTACTACTGAG
AAGTGAGAGAGAGGTCTTAAGGGGTCTTTGAATGACTATTTTTAGGTACATAAAATGCTT
TCCTCTGTTGTCTACAGCATCTCATAATCTATCCTGGGGAATTCAGCTGCCTCCCAGGGT
GAATACAGGTAATTATCCAAATTGGTGTATGTCATCTTTGTAAATGTTCACAAGAAAACA
AGTGGCCGGCGGAAGCAATGTTTTTTGGCGCCTTCCATCTTGTTCCTCTTGAAATGATTT
TCTGGGGAGGGAGATCGCAACCCGGTACTACAGTTCTTGTAAGGGTGTGCTGTTACCCTC
ATCCATATATCGATCACGTTACTGTCAGATGATTTGAATTGATAAGCTGATGTTCTGTGA
GGTACAAAAGTTAATAGCATGTTAGAGTTCTGATGGCAGTTGTTGTTTATGAATAAGCTT
CACTCCATCCTAATACCTTAAAATAACTAATTTGCTTTCCTTTCCAGGTATTCCTGATGA
CAGTCTGCCTTCTATCTTACAGTAAGTTGTTTTTCGAATTCTGTGGGCCTATTATCTAAT
AGATAACTTAGGCATTTTGATATTTGTTACCAAAGCCTGCTTAACCCATAAAGTTTTCTG
GTTCCTCTTGTTCTCTGTAGTGATGTTTCTAGACCTCCCCTTTTTTCTCTCAGATAGATG
CCCACTGATCTGCCCAGGGTCAGACGAATGCTTGTCAGTTGTAGCTTTCCAGGATTCAGC
TCCAATGAGGAGGAAACATCCTGCCTTACCCCTGTTTTAGCCTGGGAACCAGTAATTGTG
AACTCACCAGGGTTAACTTGAAGAGGGCATGAGAGCTTATTCCATAAGGAACTGTCTGAG
ACATTTGGTTACCTTTTCTTAGTTTGTCCATTAGCAACCGTAACTAAAATAGTTTTGGCC
GTTTGGGATAATTAGCTAATTGAATGATTTTTTGATTCAGGAGCAGCTTGTTGCTATATA
CCATTGAAAAGCCTTCAGAGCTGAGAGGTTAGTTGATATTTTTTGTTCCTTACAGCTTAT
GCCACCAAGTAGGCAGTTTCTATGATGAATCAAACTAGCTCACTATGACCGACAGTGAAA
ATACATGAACACCTGAGAAACTGGAGAACGCAGGGAGTGGGGGGTAACCATGTCTGAGGA
ATCTTTCACCCACAGCTTTGTTTTTCTCTAGGTACTACTAACCAATAACCTGCTTGGCTC
AAAGGTGAGTAATTTCACGGAATTCAATGCACTCAGTATATAGGGTAGGAAAAAGTGCCT
TTTAGGCCTGTGTTTGTGATGACTTACATGGAATCTCGTTCGGCTGATGACTTGCTGTTG
AGACTCTGAAATCTGATTTTCTAAGAATGATGGGTGGGAACAACGTAATGCGGGATATGA
GAAGCACTACTGACTTGGTCTTCCTCCTTTCAGGGCCAGCACCTTCTCTCTAAAGCCCAA
GAGGAGTTTGAGGTAAATGGCTTTGCAATAGTTACCATCAATGGCTGCTATATAAAATTT
TCTGTGATTTTTGTGTGTGATAGCACTGTGGTCTGGGTGAATGTACACAGACATAACTGG
CTTAATCCAAAGGCTTTGATCTCCTGAACCACCAGTGATGAATTGCTGCTCACCAGTGAT
GAGTTGAATACCGCCCCAGTCTGATCAATGTGTGACTGAAAGGTATTTTCTGAGCTGTGA
GCCTGCCTTCCAGTGACATGTTCTAAAAATTGCAAGTTATTTGAGGAGGCTTTACAGCCA
ATAGGAAGTTCTTGGGCTAAGTAGTGTTTCCTATAAAATGTGCCCTGAAACTTCTTTCTG
CCAAGCAATAGATATAATTGAGAGATTGTAAAATGTGACGTAGAATGAAAGTCTCTCAAG
ACTACATTTTTCTTTCTTGATTTTGCAGGAAAACTAGGTGTCTGTGTTCACTCCAGGCTG
AAGTTACAGGTGAGTAAACCTAAATGTAAGGTGGACTATGCTAAAAATTCCCAATGAAGA
AACTTTCACATGTCTTACTCTCTGTCCTAGTCCCAGAGCCTGTAAAGGTGAACCCACTGG
GACTGGCTGGGGGAGAAGAGGAAGATTTGTTCCAGAAGGAACTGTCTGAGGGATGATAAA
GATTTCTATACAGAGAAAGGGAGTAATAATCACTTGTTGAAAACATTGGTTTTATTTCTT
CCAGGTCTGAGCAAATAAGGTGTATAAAAAATGGTAGGTATCTGTTTAAATATTTAACTG
ATTTTATATTAGCAACCTTTTGCTCCTAGGTTACATAGTGTTAAATATTGTGTTCATTTG
TATTTTCCAATCCAATAAGAACTTTTTTTTTTTTTTAACCTCTGCAGGAATCTGTCTTGG
AGGACATCGGAAGGTGAATTTTCCAAGTCCTTGGACAACCTAGCTGTTGAAAAGCTTTCT
GGGTTTGGGGAGTATTTCAGATGTACCTTAAAGTGTTAGCAGACACAGATTAAGACACTG
GGAGCCAATGAAACAGCAGTTGAGGGTTTGCTGTGTATCACATTTCTGTATTTTATCACC
CCCTTCCTGCAACATTATTTCTCTGGAATCTACCTGCCCTTTTGTTTTTTAGATACAAGG
GCTTGGTTTTGTTACCCAGGCTGGTTTCAAGGCCATAGCTTTAAGAGATCCTCTCACCAC
AGATTTCCAAAGTGCTGGGATTGCAGGTGTGATTCATGGCACCCAGACTTTGCTGCCTTT
CTTACATAATCCAGGCCCAGAACCCAAACTCAGGCACTGCATAGATGACCAGTTTTGTAA
ACTACTGACCTAGCTTGTTGCCAATTGTTGATTGAACTTCCCATAACTCCACTTCGTGTC
TGTTCCTCTGTATACAGCCACCTTCTGTTCCCATCATGAGCCTTTAGGTCTCCATTTGCA
TATTGCAAATACTATGTTCCATGTAGGTAGCTCATGCAGGGCCTTGCTCTTCACTTCAAA
AAAGGTTCCCTTGAGGACTGGCTGTCAATTTGTGTTGCTGTGTTGGTTGTTGATGAAAAT
AATAAAATGATTGATTACATAGTCCTGTTTACTTTTTTTGTGTGTATGTGTCTCTTAGCA
TCAGTGTGTAAATTTCCATGGGAAACTGGCTTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved