Pan_troglodytes Locus Mono:126:SNORA75
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:126:SNORA75
Pan_troglodytes
Mono:126:SNORA75
4
SNORA75
1001..1137
2137
TTCTTTCCTTCATTCCACAGGTATTTGTTCTTCTTGGGATGCTTTTTCACCACTCTTTT
CTTCATTGAGCTAACTCTTTTGCATCCTGAAAACAGTAATCGAGGTCAACATGTATAGCA
CTCACTATATATTCACCCTATTCTAAGTAGTTTATGTATATGAATAAAGTTCATCCTCAC
AACTGCCCTGTAGGGCGAGTATTGTCATTTAACTCATCCTTCAGATGAGGAACCTGAAAC
ACAGAAATTAAGTAACTCATCCAAGGCCACACAGCTAGTGAGAGGTGGGGGCTGGATTCA
AATCCAGTACTACAGTCCCAGAAACCATAGTACTCTGAATCACCAGGCTCGAAGTCATCG
TCACCAGAAGCCCTTCTGCAACACTGCTCCTAAATTTTCAACATACCACTTGGCCCTTCC
ATCACACCCAGCCCCATGTGAGTATCTGTCATAGGCCTTATCCCATATGATTACAATCCC
TGGTTTCCTCTTCGGTTCCCCTCATTGCCCTGTGATCTCCCTGAGGATCTCAGTGAATCC
CGGTGAAAGAAGGAACATGGCTTTAGGCTGCAGGGGACAGATTCTCCCAGGATCCAAAGA
CATGAGACTTAAAGAAGGTCTTCCTCTTTCATGTCATCAAACTGTTCATTTTTTTCCATA
CCTCTTTTAGCAATCTGTAACCGTCTTGTTTGTTTTCATTTACTTGATTTAAAAATAAAA
TAAAATTTAAAAAAAACCTTTCCTTCCCCCAAGAATGAAGGCAGAGAATTTATCTGTCTT
GTTTGCTGCTTTACTTCAGTGCCCGGCACAGAATGTATATTCAGTAAATATGTGTCAGGT
GAGTAAATGAATGAATGAATTTGTTGTGTTTCTGTTATGGGCCAGGCACTGTGTAGACAC
CATGGTTCTTGCCTTCACAAGGTTAACAAGTTTATGGAGGGTGATGGGGAAGATGGCAAG
AGGCAGTAACTATATAGAAATGGAGAAAGAACAGGGAGCTTGGCTTCTCATTGAGCTCCT
TTCTGTCCATTGGTGGCAGTTGATGGATTTGCATGAGAAGAAGAGAGAATTCACAGAACT
AGCATTATTTTACTTTCTGTCTTTACAGAGGTATATTTGGCTGTTTTGTGAGACATTCTG
GGAAGAAAAAACAAACAAACAAAAGAACAGGGAGTTTGGAGAGCCAAAAAGAAGAAGGAT
TTAGCATTGGGTGAGGGGAAGTCCAGAAAGGGTTTCTGCAGAAAGTGACAACTTAGAGAC
CTGAAACATAGTTGGGAGATGACCAAGCAGAAGACAAAGGAAAGAGCTGAGTAAGGAAGG
AGAAGAGAGATGTTTCAGATAGAGGGAAGGAGAGGTAGGAAAGGCCTGGCTATCTGGTTA
TTTTCAGGCCTCTTGGGTGCAAATGGTAGAAGGGAGGAGCTTCATGAATTTTGAGCACCT
TGATGTCCAAGCCATGGCAGAATTGGACTTCCCTTCATGTATTCCTTTTTCCACCCCCCA
CCAGCTGTCTTTGTTGCCTTCATTGTTCCCAAAGCCTCCTTTTCATCCTTGTTTCTTCCT
GGCTGGAATAGGTTCAGTGGAACCATATTCCTCCGACAGTTTGCATTGCTTCACTTGCTC
AGGAGCCGGTAGCACTGCCAGCTGCCTCTGGGACCGGAATTTCTTACATTTATCTCATGA
GCTATACTTTTCTGTCTATTTTTGCATGTTATCCTTTGATCCTCGCAGCAACTGTGTGAG
TTCTCTCAATTCTTAGCCTAAACCTAAAACATGTCTATTCTCAGCCTCTTACCCCCATTC
CACTGCGATTCTCTTAAGTGTACTACTCTTCCTTCCTCTTCCCTACACAGATGCTTGAAT
CTGCCAAGAAATTTGCTTCCCTTTCTCTCTCTATGTATATCATTTAAGAACCCCTAAGCC
AAAAACACACCATCTGATGAATACTTAGAGAGGCCAGTAGGGTACAGTATTTATACTCAG
ATCTACGCTTTTGATCTGTTCTGGGAGGTCAAAGATATTTGGTCTTAGATTTCATACTTT
GTGTGTTTCCTTTGTTTTTGAGACTGTCTAGGTCTATTCTGTCTTTGGACAGCTTGGACT
ACTTAGACTTTTCTTTTCAGAGTGAGTTTTGATGTGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved