Pan_troglodytes Locus Poly:6:SNORD113
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Poly:6:SNORD113
Pan_troglodytes
Poly:6:SNORD113
14
SNORD113, SNORD113, SNORD113
1001..1069, 3909..3980, 6483..6554
2069
TGTATGCCAGATCTGACTTATTTGTTATCCAATGATGGAGATCATGGCTGTCACTTATG
TGGATAAGAAGCAGAGAGGCACGTTAAGTAACAGAGTTCTTGTTCTTGCTTTGAAGGGGG
CTATTCATGTTGTCCATGGAATTAATTCAAGGGAATGAATGGCTACCACAAACATAAATA
GAATTTAAAAATGCTGAGAGAGTGGATGTGAAGTGTTCTCACCACAAAAATGGCAACTAC
GAGAAGTAATGGTTATATCAATTAGCTAGAGTTAGTCATTCGACAATGTATATATACCTC
AAAACATCATGTCGTATGCGATAAATACACATAATTTTATCTGTCAATTAAAAATAAAAT
AATAAAATCAAAACCAATTAAACAATGCCATGCATGGGCAAATATTGGGAATATGTAATG
AACCATAGGTTAAGATGAATTCATTTTAGTACAGCTGATGTCCCTTACAAAGATGAATTT
ATTTTGGTACAACTGAAATCCCTTGCAAACATAATTGGAGGGGGTTGTATTCATTTTCAC
AGTTGCTTAATATTCTACTCTATTGTGCACCGTATTTTAAGAAGCTTTCTCTATTGATAA
AGATCTAGGCTTTTTCATTGTTGGGGAGGGAGCACCTACAAATACTGAACAAATTGCCAG
TGTTCCAGTTGTGGAATGAGGTGATAGGGTGTTCATTGTACTGCTATTAAGTTATGAGTA
AATTAAGCGAAAGACGATTGAGCAAAGAGCAGTAGCACACGGGATGGGTAGGAAGCAAGG
TTATCAATTAATTATAGGCACAGTCTGAGGCCCAATTAAAAAGAGATCTCGTCTACCAGC
TCTGTGGGAAACAAGCCTGGAAATAGCATTCTGCAGCAGTCAGAGGTCTTGTTCTTGGGT
TTTTGTGATTCATGGATATTAAATTATTTTGTGGGTGAAACCGTGAATGAAATAATATGC
ATAATCAATAAACAGTGCATAAGTAAATACATGAGGAAAAAGTGAGTGATGAATAGTTCT
GTGGCATATGAATCATTAATTTTGATTAAACCCTAAACTCTGAAGTCCATTAGAAAGAGA
CCTTGCTCTTCTCTGTAAGAGAGTGGAATTCAGAGTAAAAGTTCAGTTTCTTGGGCTTTA
GTGCTTCCTAGGTAGGGATCATAAATGAATCAATGAATGCATTAACAAATAAATGTGTAA
GTGAAGATAAAGACTGTCATATGTGGACCATTTATGAAAACATGTCATGAAACAAGTATT
CCTAGGAATAATATTGTAGAATACTGAATTTCAATATAATATATAGGCAAAAGCTGTCAT
TTGGAGTACATAGGAGCTGCAGACACACAGAAGCACATGGACAGATGCACCTAAGTGTCC
ATGTTGGCATTCTGGATTGGTAAGAGGTTGCTAGCTGTCAGCTTATTGAGAAGGAAAAAT
ATTTACACAAACAAAAGATTACATGACTGTAATAGAAAAGGAGCAAATATGTGCCAATTT
GAGGATGTGTTACATGACACCAGTTATGATGGATCTGATTGTATCCACTGAATTTTATAA
AAAACGACAAAAAATGGCAAGGGATAGAGTCGGTTATTTCTATGGGTTGTTTTGTTTTGT
GTTCAAGTTCAAGTGTAGAGTCTGGGATCTCTGGTAATTATATATTGTTTTTTAAGTTGA
ATGAATATAATTATATCTCAAGGGCCAACTCTGGACAGTGTGGAGCATGTGATGTGGAAT
AAAGCTTATGACTAATCCCGTTCTACCCTACTGGTGTCCTTATAGAGAAAGTAGGATCTA
GGCGCTTCTAACTTGGGTTAACTTGGGTTAAGTTCATAGAGAGGGATCATAGAATATTTC
AGTTCTGGGCTGCTGGTGGGTTTACCATATTTTATTGAGAGAGGGCCAAACACGAACCAA
TATTCAGAATGTGTCGTATGACCAGGGTTATAATTAATCCAACATTATTTAGTGAGTTTT
ATTTTTAAGAAAATTAAAAGAGGATTTTTTGGGCTGTAGCTATGGGCTATGAATATGTAG
ACAGATATTGACAGTTCTTAACCTTTGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
NC_006481
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved