Pan_troglodytes Locus Mono:192:SNORA24
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:192:SNORA24
Pan_troglodytes
Mono:192:SNORA24
3
SNORA24
1001..1135
2135
CTGTAGTCCCAGCTACTCCAGAGGCTGAGGCAGGAGGATCACTTGAGCCCAGGAGTTTG
AGTCCATCCTGGGCAACATAGCAAGACTCCATCTCTTAAAAAAACAACTTAAAAACAAAT
AAATAAAGTGCTCCTTTACATTACAAGAGAATGACTGACATTACATGTCAGTTGCCAGGT
GAGATAAATCTCATGTGGTAGCTTGAGGCACTTTTCTATTAGATGCTATAAAGGAAATAA
AGGTTTGTCCATTCATTTATTCAAAAGTAATCAATTTTTAGCTTCCAGAGTATGACCACA
GGGACACAGAGATGAACCAGTGCACCAGGAGCTCCCAGTTCTATGTATGTGGCTGGGGGA
ACACCCACAGGAAGACAACCGCACATCACACTAGCACGTAATCTCCCATCCTTCCTCTTC
CTTGTGCCACACTAGCCACAGCTGCTTTTTAGAGCCTTCCTGCACACAGGCTGCATTGCA
CCCCTCTGCCCACAGTGACTCTTTTGGAAGAGGGCACTTGACCACATCCAGGGCACTCAG
AGCCAATAACACTCAATGGATCTGTTTTAGGATGGAAGGAGCATGAAGAAAGATTAAAGC
ATGTCTAGAATTGTTGGGGACTTCCTGTCACCTTGAGAGAAACTGAGAACCTGAGAACCT
GAGAGTGAAGCTGTCTTTGGCCGTGCCTGCTGCTATAACAAAATACCTTAGACAGGGTCA
TTTATAAACAATAGAAATTTATTACTCAGAGTTCTGGTGCCTGAGAAGTCCAAGATCAAA
GCACTGGAAGATTCAGTGTCTGGTGAGGGCTTGCTCTTTGCTTCCAAAATGGTGCATTCT
GTCTGAGTCTTCCCATGGCAGAGGGAGTGGGAGGGATGATCAGGTTCCCTCAAGCCCTTT
TGTAAGGCCACCGGTCTCTTTCATGAGGGTAGAGCCCTAATCACCTCCCAAAGGGCACAC
CCCTTAATACCATCATTTTGATGGTTAAGTTCCAACATAGTCTCCATGTGTCTTTGGAAC
CTGTCAGCTGTGGCAGTTGCCCTTCCTAGCCATGGAAGAGTAAGTATATTCTTGTTTATT
GGCAAAGCTGTCACCATTTCATTGGTATCAGATTCTGACTTGCACAAGTAACATTCTTCA
CCATTAAAAACCTGGAGGCTGCTGGGTTATTGGGCAAACTTTTCCAAACTATTGTTCAAA
TGTTTCTAGAAAAAAAAAAAAAGTTTCCAACATAGGAATTTTGAGAGGGGGCACCAACAT
TCAGTCGATAGCAGAAGCCAAGTCAAAATAAGAGGAAAACAGGCCGGGTGCAGTAGCTCA
TGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGTGGATCACCTGAGGTCAGGAGTT
CGAGACCAGCCTGACCAACATGGAGAAACCCCGTCTTTACTAAAAATACAAAATTAGCCA
GGCATCGGGGTGCATGCCTCTAATCCCAGCTATTCAGGAGGCTGAGGCAGGAGAATCATT
TGAACCTGGGAGGCAGAAGTTGCAGTGAGCCGAGATCATGCCATTGCACTCCAACCTGGG
TGACAAGAGCGAAACTCCATCTCAAAAAAAAAAGTGGGGGGGGGAGGGGGCGATGAGACC
CTATCTCAAAATAGAGGAAAACGAGGAAATGAAGAGGGACTTGTCTAAGTGATGCAATTT
TGGGCACCTGTATTTAGCCATGCCAGAAGCCATCTGCTCCCCTCCCTGTCCCTCTTGGTC
CCCAACTCCACTTTTAGGCCTTTACCACTTGCTTGATGGAAAGTCACAGCCGCACCCAGG
GGCTGCCTCAGAGTGGACTCAGAGGCTTTGGTTTCCCCAGTGACTGCCCAGATGAGCCAG
GTAATATAACCCAGAAATGTGGGGAGTGAACTTTCCTATGAGTAAACTCTGACCAGCAAG
ACAGGATTCAGAAAGGAACTGAGGGGTAAAATCTCTACTTTACCTCTTCTCAGTAGACTG
TTGAGCATGACCTCCCTGGAGATGTCGCATGGGACTAGGTTATCAGAATTTGCAAATACA
AATACTTATGTTAAAACATTATTTGCGTTCATCTGAAATTCAAATTTAATCAGGCATCCT
TTTTTTGATCTGGCAGCCCAAACCCAACAACCATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved