Pan_troglodytes Locus Poly:21:SNORD115
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Poly:21:SNORD115
Pan_troglodytes
Poly:21:SNORD115
15
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1082, 2911..2992, 5203..5284, 7121..7202, 9026..9107, 10785..10866, 15553..15634, 17435..17516, 19827..19908, 21713..21794, 22510..22590, 25165..25245, 27037..27118, 28915..28996, 29978..30059, 31109..31190, 32172..32253, 34078..34158, 35211..35292, 37151..37226, 38276..38357, 40180..40261, 42001..42081, 43836..43917, 45716..45797, 47575..47656, 49469..49550, 52532..52613, 54412..54493, 56264..56344, 57162..57243, 59121..59202, 61499..61580, 63352..63433, 65224..65305, 66767..66848, 68627..68708, 70464..70545, 72364..72445, 74216..74297, 76124..76205, 78191..78272, 80055..80136, 81943..82024, 83796..83877, 85457..85538
86538
ACATAGAATCGGTAAGATGAGGAAAAAGCATAAAACGGTCAAAAACACTGGGATAATTC
AAGGTTCATTTTGACAATGGTAATACAAATTGAAAAACTGACAGAAAATACATCTTACAT
TAGAAAACATACAAGAGTAGTTGTATACAAACGAAGACACGTACCAAAAATGTTACAAAA
TATGAATGCATATACATAAAAAAATGTAGTTTGAAACAATTCAAAAGTAAAATGATGCAA
GACATTAAAATATTCACAAACACGCTCGAAAAATAAGAGCTGACGCCCAAATTAGACCAG
TTCAACGGAAGTGTGGGGTGTGGTTGGGGATCCGCCGCAGAAATCACGTGGCGCCCAGGC
CAAGGCTGCAATTTCCCATGCCGCTTGGAGAAGACGCCTGGGAGGGCTCCCACCATGCCC
AGGGGCAGGCTATGTGACTGCCCGGTCTGCAGCTGTAAGTGGTTTCTGGGCCAGTCTCTT
TGTCTGGTCATGACCTGGTTGGTGGCCCTAGCTTGTGCCGAGTGGTCCCGGAGTGGCCCA
GGGGGTTGTGTGTGGGGAGCCAGCGTGGGCAGCGGAGGTGCTCCCTGGGGCCTGCAGTAG
GGCACAGCCTCTGCATCTTGTGTGAGCCCAGTGACCCGCCTGTCCTGTCCTTCCAGGGTT
GGGTGGCGGGGAGGGCCAAGGGTGTGCCCTGCGTCCGTGACGGGTCAGCGTTTCCAGCAA
ATGGGTCCATGGAGGGAGAGCATACCTGAGCCGGCGGGCTCTACCACCTTCATGAGGTTC
TGTTTGGACACCTGTCCTACTCCTGTTCCCCCAGATGGTGACCACGGAGGAAGACTTGTG
TTGGGCCCAGTGGCCCTCGGCCAGTGTCCGTCTGCCAGGTGCTAGCCCCCGGTGCGCTGA
AGCTCAGGCCGTTCCTGGTGCCCTGGCCTCCTGCCCTGAGCTGTGGTGAGCCCATCCGGG
TCCTGCTGGATACATGGGCGGGGAGGGGGGTGCTCTGGGTTGGGTTGATGATGAGAACCT
TATATTATCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGG
CCCAGCCTAGGTGAGAATTTTGGAAGAGGACGCTGGGATCCGAGGCCCCCGACAGGGCCA
CTGTATTTTGGGCTGCAGACCTAGAGGTCCTGAAGGGCATCTGAAGGGGGCCCAAGCCTA
TCTCTGAGCTCCCCCGTGAGGCAGTCCAGGATCCCTGTGTGGGCATATGCTGGGGCTCTG
GTTCCCTAGGGGCAGGGCATGTGGGTGGCTCCTCCCTGACCCCCATTTTCCCCTGTGTCT
TTCAGTGAGCTCTTCTGCCCAGGCAGGCCCCCTGGCATTGACCGGCATAGGTGAGTGGAT
CCTGCTGGGGTCATGGGCCATGAGCCAGGCTGCTGGGGTCGCCAAGGGTCAGCCTTTGGG
ACAGGAGGGTTTCCTTAGGGAGCCAACCTGAATCCCCACTGGGGAGGGCTAAGTTCTCCA
GGAGGGCAGCTTCCTTGGGAGTCTGACCCAAGGAGGATATCTTCTCTAAAGCCCTGCAGT
GGTGAGGGTGGTCCAGGCAGCAAAGGGTTCCTTCAACCCCACCCAGGACAGCGCCCAGCT
GAGACTCAATGTGCAGGTCTGGCCATGAGGACTGCCCAGGTCACATAAGGGGGTCCATAG
GAGCTCCGGGGCACCACAGGGGTCACACAGGAGCTCTCCTTCCCCAGAGAGGGGTGAGCG
ATTGGGCCTATGGGGTCAGGCCTTTGGAGATCTAGGATTGGGCCCCACCCATGAACCTGA
ATGGGACTGAGCCTTTCAGCAATGGACCATCCCAGTGGTGCCTCTGAGCCTAGTCGGGGG
TGATGTGGCTTCAAGGGGGTTGGGTCAAGGCTGAGCTCTGGCCGGTGCCTGGTAGTGCTG
CAGGCTGGCCCTGGGACTCGCTGGCTTTGGGCAAAGGGGCCAGCCCGTGTCCCACTGGGG
GTCACCCCTTCCCTGTGGGCAACTAGCAGGAAGGGTGGCATCCTTAGCTGGGAAGGCCCA
CTGTCGAGGGTCCTGTCCAGGGAATTTGCCTCCCAGGCTTCTGATCCACGGACTCACCTC
CAGGGTGGTGGGGTCTTGGGCTCAAGGAAAGGAGAAGATACCCTGTGTTCCCCGATTGGC
TGAGTGTGGCTTGGCTCTGTGTTTGGGAGGTGTGTAGGGTATGAATGGGGACCCACCAGA
GAACACACATGGCCCAGGGCCCCAGGTTATGATTTCCCATGCACACTTGGAGAGAACTCT
GGGTGGGTGCCCTCCACTCCCAGGCACAGGCTATGCAACTGCCAGGTCTGCAGTGGCATG
TGGCTTCCAGGTCAGCCTCCTTGGTTGGCCATGAGCAGGTTGGTTGCCCTGTCCTGTGCC
CAGTGGTCTTGGAGTGGCCCAGGGGTCCTGCAGGGGAGCTGGTGTGGGTAGTGGAGGTGC
TTGTGGGGCCTGCAATAGAGCACAGCCTAGGTGCCTTGCACGAGCTCAGTGACCCACCTG
CCCTGTCCTAGTCCTAGCTCAGTGACCCACCCCCCCCCCTTGCAGTGATGGGGAGTACCA
AGCGTCTCCTGCGTCTGTGATGGGTCAGTGTTCCCATCACATGGGTCCATGGAGGGAGAG
CATGCATGAGCTGGCACCACCCACCACCTTCCCACTATGGAGGCATGAGGCCATGTTTGG
ACACATGTCTTCTTGTCCCCCCAGACAGTGAGCCTGGAGGAAGACTTGCCTTGGTCCCAC
TGTCCCTGGGCCAGTGTCCATCAGCCAGGTGCCCAGACCCCAGTGCGCTGAAGCTCAGCC
CGCCCTGGCACTCTGGTCTCCTGTACTGAGCTGTGGTGAGCACATCCAGGTCCTGCTGGA
TGTTTGCATGGGGAGGGGCTTTCCCCGGGTTGGGTCGATGATGAGAAGCTTCTGTTTTCT
TGAAGAGAGGTGATGACTTAAAAATCATACTCAATAGGATTATGCTGAGGCCCAGCCTAG
GTGAGAATTTTGGGAGAGGATGCTGGGATCCCCGGCAGGAGGGATTTTGGGCTGGAGACC
TGGAGGCCCTGAAGGGTATCTGCAGGGGCCCCAACCCTGTCTCTGCACTTGTCTGTGAGG
CAGCCCAGTTTCCCTGTGTGGGCTTCGTGTCAGTGCTCTGGTTCCCTGGAGCAGGGCACG
TGGGTGGCTCATCCCTGAAGTCACGTTCTCCCTTTGTGTCTTTCAGTGAGCTCTTCCGCC
CATGAGGGCCCCCTGGCCTTGAGCAGCATAGGTGAGCGGATCCTGCTGGGCTCATGGACC
AGGCCACATGGGGTCACTGAGGGTCAGCCTTCAGGACAGGAGGGATTCCTCAGGGAGACA
ACCTGAATCCCCACTGGTGAGGGATTGGTTCTCCAGGAGAGCCGCCTCCTTGGGAATCTG
ACCCAAGGAGGACACCTTCCCTGAAGCCCTGCAGGAGTGACAGTGGTCCAGGCAGGAAAG
GGTTCCATTAGTCCCATGCAGGGCAGCTCCCAGCTGAGACTTGGTGCTAGGGTCTGGCCT
CGAGGACTGCCCAGGCCACATGAGGCAGGGTCCCAGGCTGCTATTTCCAGTGCATGCTTG
GAGAGGGAGCCTGGGTAGGCCCCCTCCCTGTGCAGGGGCAGGCTGTGCATCTGCTGGGGC
TGCAGCGGTGCCTGCCTTCAGGACCAGCCTCCTTGGTTGGCCTGAGCTGGATAGTGGCCT
TGGCCCCACCCAGGGGTCACGGTGCAGCCCAGGAATTGCAGGGGAGTTGGCATGGGGAGT
GGAGGTGCTCCAGGGTCTTGCAGTAGGGCACAGCCTGGGCATCTTGCTGGAGCCCAGTGA
CCAGCCTGCCCTGTTTTCCAGGGTTCAGTGGCAGGGAGGACCAAGGGTCCCCCACGTCCA
TGACTATCACTGTTTCACATGGATCCCATCAGGTGGGTCCATGGAGGGAGAGCATGTGTG
AGTCAGCACCCCCTGCCTCCTTTCCCACATGGAGGCATGAGGTTCTGTTTGGACACTTTT
CCCTGTCTCTCCAGATGGTGACCCTGAAGGAGGACTTGTGTTGGGCCCAATGGCCTGGGG
CCAGTGTCTGTCAGCCAGGTGCCCAGCCCCTGGCGCGCTGAAGTTTGGGCCCTTCCTGGT
GCCCTGTTCTATCGGGGGAACCCGCCCCCAATAATTCAACGTAGGTCCTTTTCTATTTTC
CCTAAGTGTCGGCCGGTCTGAGAAATAAAGGGAAAGAGTACAAAAGAAAGAAATTTTAAA
GCTGGGTGTCCGGGGGAGACATCACATGTCGGCAGGTTCCATGATGCCACCCAAGCTGCA
AAACCAGCAAGTTTTTATTAGTGATTTTCAAAGGGGAGGGAGTGTACAAATAGGGTGTGG
GTCACAGAAATCACATGCTTCACAAGGCAATAAAATATCACAAGGCAAATGGGGGCAGAG
CACCGGGGCCAAATTGAAATTGCTAATGAAGTTTCGGGCACACATTGTCATTGATAACAT
CTTATCAGGAGACAGGGTTTGAGAGCAGACAACCGGTCTGGCCAAAATTTATTAGGCAGG
AATTTCCTCGTCCTAATAGGCCTAGGAGCGCTTCGGGAGACCGGGGCTTATTTCATCCCT
TATCTTCAACTGTATAAGACAGACATTCCCAGAGCGGCCATTTTAGAGACCTCCCCCTAG
GAAGGCATTCTCTTTCTCAGGGTTGTTCCTTGCTGAGAAAAATAATTCAGCAATATTTCT
CCTATTCGCTTTTGTAAGAAGAGAAATATGGCTCTGTTCCGCCCGGCTCTCAGGCAGTCA
GGCCTGACGGTTGTCTCCCTTGTTCCCTGAACATCGCTGTTATCCTGTTCTTTTTTCAAG
GTGCCCAGATTTCATATTGTTTAAACACACATGTTTTACGAACAATTTGTGCAGTGAACG
CAATCATCACAGGGTCCTGAGGCGAAATACATCCTCAGCTTACGAAGATGACGGGATTAA
GAGATTAAAGTAAAGACAGGCATAGGAAATAATAAGAGTATTGATTTGGGAAGTGATAAA
TGTCCATGAAATCTTCACAATTTGTGTTCTTCTGCCATGGCTTCAGCAGGTCCCTCCGTT
TGGGGTCCCTGACTTCCCTCAACACTGGTCTCTTCCACTGAGCCTTAGTGAGCCCATCTA
GGTCCTGCTGGATGCATGTGTGGGGAGGGGGGTGCCCTGGGTTGGGTCAATGATGAGAAC
CTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTTAGTAGGATTACGCTGA
GGCCTAGCCTAGGTGAGAATGTTGGAAGAGGATACTAGATGCTGAGGTCCCTGGCTGAGC
TACTGTATTTTGGGATGGAGATCTGGTGACTCTAAGGGCACCTGAAGGGCCAGACCCTGT
CTCTATGCTCCTCCATGAGGCAGCCCAGGCTCCCTGTGCAGGCTTGCTGTTGGCACTCTG
GTTCCCTGGGGTGGGACATATTGGTGGCTCCTCCCTGAACCCTGTTCTCCCCTTGTGTCT
TTCAGTGAGCTCTTCCACCAAGGAGGGCCCCCTGGCATTGACTGGCATAGGTGAGTGGAT
CCTGCTGGTGTCATGGGCCATGGGCCAGGCCACGTGGGGTCACCAAGGGTCAGCCTTCAG
GAAAGAAGGGTTTCCTCAGGGAGCCAAACTGAATCCCCACTGGGAAGAGATGGGTTCTCC
AGGAGGGCGGCTTTCTGGGAATCAGGAACCAAGGAGGACGCCTTCCCTGAAGCCCTGCAG
GGGTGACGGTGGTCCAGGCAGGAAAGGGTTCCTTCAATTCCACCCAGGGCAGCTCCCAGC
TGAGTCTCGGTGCTCGCGTCTGGACTGCCCTGACTATGTGGGGGGCCACAGGGGCTCCGG
GGTGCCTTGGGGGTCACAGAGATGCTCTTTGTCCCTGGAGAAAGGTGGGTGATCAGGCCC
ATGGAGTTGAGCAGTGGAGATTCAAGGATTGCACCTGACACATGGTCCTGAATGGAACCC
ACCCTGCTGAGCAATGGGCCATCCCATGGGCCTCTTCAAGCCTGAAGAGGGGTGGTGCTG
TTTCACTGGGTTTAGGTCAAGGCTGAGCTCTGGCCGGTGCCTGGTGGTGCTGCAGTCCAG
CTGTTGGACTCGTGGGCTTTGGGCCAGTGGGGCAGCCTGCATCCCTCTGGAAGTCACCCC
TTCCCTGTGGCTGGAAGTTACCCCTTCCCAGTGGGCGAATGTGGGGAAGGGTCGCCTCCT
GAAGTGAGAAGGCCCACTATTGAGGGTCCTGTCCTGGCAATTTGCTGCCCATGCTGCTTC
TGAGCCATGGAGACACCTCCAGTGTGGTGGGATCTTGGGCCCAAGGAAGGGAGAAAACAC
TGTGACCCCCGATTAGCTGAGTGTGGCCAGGCTGTGTGTTTATGAGGTGTGAGGGGCATG
GATGGAGACTCACCAGAGAAAGCATGTGGCCCTGGGACCCCAGGTCGTGGTTTCCAGTAT
GTGCCCAGACACAGCACATGGGTGGGTGCCCACCATGCACAGGGACTGGCTATGTGACTG
CCAGCTGTGCAGCAGCAGCATCAGGCATATGGGCCAGCCTCCTTGGTTGACAATGAACTG
GTTGCTGGCCCTGGCCTGTGCCCAGTAGTCCTGGGGTGACCCTGGTGTCATACAGGGGAG
CTGGCATGTGTAGTGGAGGTGCTTGTGGGGCTTGCAGTAGGGCACAGCCCTGGCTTCTAG
CCTGAACCCAGTGACCTGCCTGTCCTATCCTTTCAGTGTTCAGTGGCGGAGAGAGCATCG
GGTGCCCTGCATCCATGACGGGCAAGTATTCCACATGGATCTCATCACATGGGTCCATGG
AAGGTGAGCATCCCTGAGCTGGCACACCACACCTTCTGTCCACATGGAGGGGTGAGGTTG
TGTTTGGACACTTGTCCTCTTCCTGTTCCTTGAGATGGTGACCCCAGAGGAAGACATGCG
TTGGGCCCGCTGTCCCTGGCCAGTGGCCATCAGCCAAGTGCCTAGCCCCTATTGCACTGA
AACTCGGGCCCTTCCTGTCACCTTGGTCTCCTGCGTTGAGCTTGGGTGAGCCCATCCGGG
TGCCACTGGATGCCTAGGCAGGGAGGGGGCTGCCCTGGGTTGGGTCGATGATGAGAACTT
TATATTGTTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGG
CCCAGCCTAGGTGAGAATTTTGGAAGGGGACACTAGAATCCCGAGGTCCCCAGCAGGGCT
GCTGTATTTTAGGCTGGATACCTCGAGGCCCTGAAGGGCACCTCATGGAGGGGCCCAATC
CTGTCTGTGCTCCTCTATTAGGCACACCAGACTTTCTGTGTGGGCTTGGTGTCCACGCTC
AGCTTCCCTGGGGTGGGACACGTTGGCGGCTCCTCCGTGAGCCCCATTATCCTCTGTGTC
TTTCAGTGAGCTCTTCCCCCCAGCAGACCCCTGGGATTGACGAGCATAGGTGAGTGGATA
CTGCTGGTGTCATGGGCCATGAGCCAAGCTGCGTGGGGTCCCCAAGGGTCAGCCCTCGGG
CCACCTGGGTTTCCTCAGGAGCTGATCTGAATCCCAACTGGGGATGTGTTCTCCAGGAGG
GCAGCTTCCTTGGGAATCGGACATAAGGAGGAGGCCTTCTCTGAAGCCCCGCAGGGGTGG
CAGTTGTCCAGGCAGGAAAGGGTTTCCTCAGCCCCACGCGGGGCAGTGCTCAGCTCAGAC
TTGGTGCTTGGGTCAGGCCTCTAACGTGGCCAGGCCACATGAGGGGGGCAACAAGGGCTC
CGGGGAGCCAAGGGCATCTCACGGGGGCTCTCCAACCCTGGAGAAGGGTGGGTGATTCGG
TCCATGGGGTCAGGCCATGGAGATTCATGGATTGCAGCAAACCCAGGACCCTCAATGGGA
CTGACCCTATAGGCAGTGGGCCCTCCCAGTGGCACCTCTTTGAGCCATTTGTGGGGCGGC
GCTGTTTCTCTGAAGTTGGGTCAAGACTAGCTCTGGCCAGTGCCTGATGGTGGTGCAATC
CAGTCCTGGGACTCGTGGGCTCTGGGCCAAGGCTGCAGCCCATGTCCCGCTGGGGGTCAC
CCCTTCATTGTGGGCGAGTGGCAGTAATGTCCTCCTGAGTTGGGAAGGCCCGCAGTGGAA
GGACCTTTCCTGGAAATTTGCAGTCCAGGCTGCTTCTCAGCCATTAGGACAACTCCAGTG
GGTTGGGGGGCAGGGGCGGGTCTTAGGCCCAAAGAAAGGAGAAGATACCATATGTCTCCC
GGTTGGCTGAGTGTGGCCCTGCTCTGTGTGTGGGAGGTGTTGTGTGGGGCATGGATTGGG
ACACACCAGAGAAAGCTTGTGGCCCTGGAGCCCCAGGCTGCGATTTCCATTGCACCTTGA
GGAAAGGAGGGTGGGTGCCCTCCATGCACAGGGCAGACTGTGCAACTGCCAGGTAGGCAA
CAGCACGTGGTGTCCGGGCCAGTGTCCTTGGTTTGCTGTGAGCTGTTTGGTGTCCATGGC
CCCTACCCAAGGGTCCAGATACCACCCGGGGTCATGCAGGGAGCTGGCATGGGCAATGGA
GGTGCTCAAGGGGCCTGCAGTAGGGCACAGCCCAGGTGTCTTGCCTGAGCCCAGGAACCC
ACCTGCCCTGTCCTTCCATGGTTCAGTGGCTGGGAGAGCAAAGGGTTCCCCTGATCTATG
ACACATCAGTGTTTCCCATGGATCCCATCACATGGGTCCACGGAGAGAGAGCATGTGTGA
GCTGGCACCCCCAACCCCATTCCCTGTATGGAGGCGTGAGCCCATGGTTGGACACATGTC
CTCCTCCTGTCCCCCCAGATGGTGACTGTGGAAGAAGACTTGCTTTGGGACCGCTGGCCC
CAGGCCAGTGGTTGTCATCCAGGTGCCCAGCCCTTGGTGCACTTGAGCTCAAGCCCTTCC
TGGTGCCCTGGCCTCCTGCCCTAAGCTGTGGTGAGCCCATCCAGGTCCCACTGGATGCAT
GCATGGGGAGGAGGGTGCCCTGGGTTGGATTGATGATGAGAACCTTATATTGTCCTGAAG
AGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTTGGTGAG
AATTTTGGAAGAGGATGCTGAGATCCCAAGGTCTCTGGCAGGGCCGCTGTATTTTGGGCT
GGAGACCTGGAGGCCCTGAAGGTCATCTTAGGGGTGCCCGACCCCATCTCTGCGCTCCTC
CTTGAGGCAGCCCAGGCTCCCTTGGGGGCTTGGTGTCAGCCCTCCAGTTCCCCGGGGTTG
AGGCACATTGGAGGCTCCTTCCTGAGCCCCCATTCTCCCCTGTGTCTTTCAGCGAGCTCT
TCTGCCCAGGGGGACCCCTGGCCTTAAGTGGGATAGGTAAGTGGATCCTGCTGGGGTCGT
GGACCATGAGCCAGGTCGCTTTGGGTCACTGAGAGTCACCCTTCAGGCCACGAGGGATTC
CTCAGGGAGCCCATCTGAAACCCACCAGGGACGGATGGTTTCTCCAGGAGGACAGCTTCC
TTGGAAGTCGGTCCCAAGAAGGATGCCTTCCCTGAAGCCATGCAGAGATGATGGACGTCC
AAGCAGGAAGGGCTTCCTTCAACTCAACGCAGTGCACATCCTAGCTGAGACTCAGTGCAC
AAGTCAGGCCTGGAGGACTTCCCAGGCCACATGAGGGGGTCCACAGGGTCTCCGGGGGCC
ACGGGTGTTATGAGGGTGCTCTCTGTCCCCGAGGCTTGCAGAGGGGCAGGGTGTGGGTGA
TCGGACTTATGGAGTCAGGCTGTGAAGATTCAAGGATTGGGCCCAACCCATGGCCCAGCA
TGGACCGAACCTGTAGAGCAATGGGCCATCCCGGTGGTGCATCCTTGAGCCTTGTGGGGG
CGGTGTGGCCTTAGTGGGGTTGGGTCAAGCCTGACCTCTGGCCTTCACCTGGTGGTGCTG
CAGGTTGGCCCTGGGAATTTGGGCTTTCGGCCAAGGGTGCAGTCTGTGTCCCGCTAAAGG
TCACCCCTCCCCAAAGTGGAGTGGCCAGAAGGATGGCATCTTGTGGTAGAAGTCCCACTG
TCAAGGGTCCTGTCCTGGCAATTTGTTGCCCAGGCTGCTTCTAAGCCATGGGTTCACCTC
CAGAGTGGCGGGGTCTTGAGCCGAAGGAAAGGGGAAGAAATCATGTGTTCCCTGATTGAC
TGAGCATGGCCTGGCTCTGCGTTTGGAGGTGTGCGGTGCACGAATGGGGACCCATCAGAG
AAGGCATGTGGCCCTGGGGCTCCAGGATTTGATTTCTGGTGTGAGCTTTTAAAGGGGGTC
TGTAGTGGCACGTAGCATTCAGGTCAGCCTACTTGGTTTGCTCTGAGCTTGTTGGTGGTC
CTGGCCCTGCCCAGTGGTCCCATTGTGGCATAGACTCATGTGGGGGAGCTGTGGCAAGGA
GGACCAAGGGTTCCCCACATTCATGATCATCACTGTTTACATGGATCCCATCTCTTGAGT
CCATGGAGGGAAAGCATGTGTGAGCCAGCACCCCCTGCCCACTTTCCTGCATGGAGGCAT
GAGGCTGTATTTCTATACGTGTCCCCCACCCCTCCAGATGGTGACCCCAGAGGAAGACGT
GCATTGGGTCCGCTGGCCCCAGGCCAGTGTCTCTCAGCCATGTGCTCAACACCTGGTGAG
CTGAAGCTCAGGGCCTTCCTGGCATCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATC
TGGGTTCCTCTGGATACGTGTGCAGGAAGGGGGATGCACTGGGTTGGGTCAATGATGAGA
ACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCT
GAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGATGCTGGGATCCCAAGTTCCCCAGCAT
GGCCACTGTATTTTAGGCAGGAGACCTTGAGGCTCTGAACGGCGTCTCCGGGGGGCACAA
CCCTGGCTCTGGGCTCCTCTGTGAGGCAGCCCAAGTTCCCTGTGCAGGCTTGGGCTCTGG
TTCCCTGAGCCCCCATTCTCCCTTGTGTGTTTCAGTGAGCTCGTCCTCCTAGGTGGGGCC
CCCAGGCATTGACCGGCATAGGTGAGTGGTCCTGCTGGGGTCATGGGTCATCAGCAGGTT
GGAGTCACCAAGGGTCAGCCTTTGAGACAGGAGGGTTTCCACAGGCAGCCGACCTGAATT
CACACCATGGAGGGATAGATTGGTCCTCCAACAGGGCTGTTTTTTTTCGGAATCAGACCC
AAGGAGGATACCTTCCCTGCAGCCCTGCGGGGATGACGGTGGTCCAGGCAGGGAAGGGTT
CCTTCAGTCTCACGCAGGTCAGCTCCCAGCTGAGTCTCAGTGCATTGGTCTGGCCTCCAG
GACTGACCAGGCCACGTGAGGGGGGCAACAGGGGCTTCGGGATGCAGTGGGGTCACAAAG
GATCTCTCCATCCCCAGAGAAAGGTGGGCATAGAACCCATGGATTCGAGCTGCAGAGATT
CAAGAATCGCACACGAATTATTGCCCTGAATGGGACCGACCCTGTTGAGCAATGTCCCAT
CCCAGGNCACCTCTTTGAGCCCTGAAGGGGGTGGTGCTGTTTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCTGTTGGGGATTTCC
CCTTTCCCGGTGGCTGGAAGTCACCCTTCCCCATTGGCCCTGTTAGGGAAGGGTGGCCTC
CTGAGGTGGAAGGCCTGCTGCTGAGGGTCTTGTCCCTGGAATATGCCACCCACACTGCTT
CTGAGCCATAGGGTCACCTCCAGGATAGTGGGTATTGGGCCAAAGGAAAGAAGTCACCAT
GTGTCCCCTGATTAGCCAAGTGTGGCCCTCCTCTGTGTTTAGGAGGTCTGTGGGGCATGC
ATGGGGACCCACCAGAGAAAGCATGTGGCCCTGGGACTCTAGGTTGTGATTTCCAGTTCA
TGCTGGCAATGCACCGGGGCAGGCTATGTGACTGCCAGCTTTGCAGCGGCATCCGGCATT
CGGGCCAGCCTCCTTGGTTGGCCATGAACTGGTTGGTGGCCCTGGCCTGTGCCCAGTAGC
TCTGTTGTAATCCTGGGGTCATGCGAGGGAGCCGGCATGGGCAGTGGAGGTGCTCATGGG
ACCTGCGGTAGGACACAGCCAGGTCTTCTTGCCCGAGCCCAGTGACCCGCCTGCCCTGTC
CTTCCAGGGTTCAGTGGTTGAGAGAGTACAGGGTGACTTGTGTCTGTGACAAGCCAGTGT
TCTGCATGGATCCCATCACATGGATCCATGGACGGCAAGCATCCCTGAGCCGCCACACCC
CACCTTCTGCCTCCATGGAGGGGTGAGGTTGTGTTTGGACGCCTGTCCTACTCCTGTTTC
CCCAGGTATTGAGCCTGGAGGAAGACTTGAATTGGTCCCAATGGTCCCAGGCCAGCATCC
ATCAGCTAGGAGCTGAACCCCTGGTGCACTGAAGATTGGGCACTTCCTGGCACCCTGGTG
TGCTGCACCGAGCTGTGATGAGCACATCCGGGTCCTGCTGGATGCATGCGCCGGGAAGGA
CGTGCCCTGAGTTGGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACT
TAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGTCTAGGTGAGAGTTTTGGAAGAG
GATGCTGGGATCCTGAGGTCCCCTGGTTTTGGGCTAGAGACCTGGAGTCTCTGAGGGCAT
CTAGAGGGGGCCCAACCCTGTCTCTGCACTCCTCCGTGAGGCAGACCAAGCTCACTATGT
GGGCTTGGTGTAGGCACTCCTGTTACCTGGGGGCGGGGCACTTTGGCGGCTCCTTCCCGA
GCCCCGATTATTCCATGTGTCTTTCTGTGAGCTCTTCTGCCCAGCAGACCCCCTGGCATT
GACCAGCATATGTGAGTAGATCCTGCTAGGGTCATGGCCCATGAGCCAGGCTGTGTGGGA
TCGCCAAGCATCAGCCTTTAGCCGCAAGAGTTTTCTCAGGAGCTGTCCTGAATCCCCACT
TGGAATGGGTTCTCCAGGAGGGCGGCTTCCTTGGGAATCAGACCCAAGGAGGATACCTTC
CCTGAAGCCCTGCAGGGGTTGCGGTGGTCCAGACAGTAAAGGGTTTCCTCAGCCCCATGC
AGGGCAGTGGCCCGCTAAGACAGTGCTCAGATCAGGCCTCTAGGATGGCCAGGCCACATG
CAGGTGGCTACAAGGGCTCTGGGGTGCCAAGGGGGTCTTGAGGGGGCTCTCCAACCTTGG
AGAGGTGTGTGTGATTCAGCCCATGGGATCAGGCCTCAGATTTGCAAGGATCTCTCCAAA
CCCATGGCCCTGAATGGGATTGACCCTATTAAGCTATGGGCCATCCCAGTGGCATCTCTT
TGAGCCAAGTGTGGGGCGGTGCTGTTTCCCTGAGGGTGTGTCAAGACTAGCTCTGGCTGG
CACTTGAGGATGCTGCAGTCCGGCCCTGGGATTGGTGGGCTTTGGGCCAAGGGTACAGTC
CATGTCCCACTGGGGGGGTCACCCCTTACTTGTGGGCAGTGACAGGAAGGCTGTCCTCCT
GAGGTGAGGAGACCTGCTGTAGAAGGACCTGTCCCGGAAATTTGCAGTCCAGGCTGCTTC
TGAGCCATGGGGTCACCTCTAGGGGGGCCGGGTCTTGGGCCCAAGGAAAGGAGAAGACGC
CATGTGTCCCCCGATTGGCTGAATGTGGCCCCGCTCTGTGTAGGAGGTTTTGTGTGGGCA
TGGATGGGGACCCACCAGAGAACACATGAGGCCCTGGGACCCCAGGTTGTGATTTCCCAT
ATGGTGTGGAGCGGGGCCTGGGTGCTCGCCCTCCACACAGGGGCAGGCTGTGCGACTGCC
AGATCGGCAGCAGTTCATAGCATCCAGGTCAGCCTCCTTGGTTGGCTGTGAAAGGGTAGG
TGGCCCTGGCCCGCACCCAAGGGGCTGATACAGCCCTGGAATTATGAGAGGCAGGGGGCG
TGGGCAGTGGAGGTGCTCAAGGTGCCTGCAGTAGGGCATAGCCAGGGCATCTTGCCTGAG
CCCAGTGACCCACCTGCCCTGTCCTTCCAAAGTTCAGTGGTGGGGAGGACCAAGGTTCCC
CCGCGTCCATGACACGTCAGTGTTTCACATGGATCCCATCACATGGGTCCATGGTGGGAG
ACCAATCGTGAGCTGGCATCCCCCAGCCCCTTCCTGCATGGATGCGTGAGGTTCCGTTTG
GACACATGTCCACCTCCTGTCCCCCAGATGGTGAGACCAGAGGAAAACTTTCACTGGGCC
CGCTGTCCCTGGGCGAGTGGTCATCAGTCAGGTGCCCAGCCCTTGGTGCACTGAAGCTCA
GGCTCTTCCTGTTGCCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCTGGGTCCCAC
TGGATGCATATGTGTGGAGGGGGGTGCCCTGAGTTGGGTCAGTGATGAGAACTTTTTACT
GTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGC
CTAGGTGAGAATTTTGGAAGAGGACACTGGGATCCCGAGGTTCCCTGGCAGGGCCACTGT
ATTTTGGGCTGGAGTCCTCAAGGCCCTGAAGGGCACTTTGGGGGTGCCCAACCCTGTCTC
TGCACTCCTCTGTGTGGCAGTCCAGGCTTCTCATGCGGGCTTGGTGTTGGCACTCTGGCT
CCCAGGGGCTGGGGCAGGTTGGCGGCTCCTCCCTGAGCCCCTGTTCTCCCCTGTGTCTTT
CAGTGAGCTCTTCTGCCCAGGTGGGCCCCTGGCCTTGAGCAGCATAGGTGAGTGGATCCT
GCTGGAGTCATGGCGCATGAGCCAGGCCACGGAGGGGCGCTGAGGGTCACCCTTCAGGCC
ACGAGAGTTTCTTCAGGGAGCCGAACCTAAATCCCCACCAGGNACGGATAGTTTCTCCAN
GAGAGCAGCTTCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGATCTTAG
TTGAGACTTGGTGCACAGGTCAGGCGTGGAGCACTGCCCAGGCCACATGAGGGGGTCCGC
TGGGTCTCCGGGGGCCATGAGTCTCATATGCGAGCTCTTCTTCCCCGAGGCTTGCAGAGG
GGTTGGGTGTGGGTGATCGGGCTTATGGAGTCGGGCCATGAAGAATCAAGGGTTGGGCCA
CACCCATGGCCCTGAATGGGGCAGACCCTGTTGAGCAATGGCCATCCCAGTGGTGCTTCC
TTGAGCCTGGTGGGGGTGGTGCCGCCTCAGTGGGGTTGGGTCAAGGTTGAGCTCTGGCCG
GCACCTGGTGTTTGGTCCTGGGCATCGTGGGCTTTGGGCCAAGGGTGCAGCCTGTGTCCC
GCTGGAGGTCACCCCTCCCCAAAGTGGAGTGGCTGGAAGGGTGGCATCCTGTGGTGGAAG
GCCCACTGTCAAGGAACCTGTGCTGGCAATTTGCTGTCCAGGCTGCTTCTGAGACATGGG
GTCACCTCCAGGGTGGCAGGGTCTTGAGCCAAAAGAAAGGAGAAGATATCATGTGTCCCT
TGATTGGCCGAGTGTGGCCTGGCTCTGTGTTTGGGAGGTGCATGATGCATGAATGGGGAC
CCACTAGAGAATGTACATGGCCCTGGGGCCCCAGGATGCGATTTCTGGTGTAGGCTTGTA
GAGGGCACCTGGACAGGTGCATTCCACACCCAGGGGCAGGCTATGTGCCTGCCAGTTCTG
CAGCTGCACATGGCGTCCAGGCCAGCCTCCTCAGTTTGCCATGAGCTGGTTGGTGGCCCT
GGCCATGCCCAGTGCTCCCAGTGTGGCCCAGAGTCATGTGCGGGAGTTGGCGTGGGAAGT
GGAGGTGCCCAGGGTCATTCAGTAGGGTGCAGCCTGGACATCTTGCTGGAATCCCATGAC
CCGCCTACCCTTTCCTTCCAGGGTTGAGTGGCAGAGAGGGCCAGGGGTTCCTTGTGTGCA
TAACCGTCACTGTTTTACATGAATTCCATGTATTGAGTCCATGGAGGGAGAGCATCTGTG
AGCCAGCACACCCTGCGCACTTTCTTGAATGGAGGCATGAGGCCGTGTTTGGACACCTGT
CCCCCACCCCTCCAGATGCTGACCCAGGAAGAAGAATTGCATTGGGCCCGCTTGGCCCTG
GGCCATTGTCCCTCAGCCAGGTGCTCAATCCCTGGTGAGCTGAAGCTCAGGCCCTTCCTG
GTGCCCTGGTCTCCTAAACAGAGCTGTGGTGAGCCCATCTATGTTCCAGTGGATGCATGC
ATGATTTAGGGGGTGGTGCCCTGGGTTGGGTTGATGATGAGAACCTTATATTGTTCTGAA
GAGAGATAATGACTTAAAAATCATGCTTAATAGGATTACGCTGAGGCCCAGCCTAGGTGA
GAATTTTGGAAGAGGATGCTGGGATTTTAAGGTCCCTGGCAGGGCCACTGTGTTTTGGAT
TGGAGACCTCCAGGCCCTGAACAGCATCTCGCGGAGTGGGGACTCTACCCTGTCTCTGCA
TTTCTAGGTGAGGCAGCCTAGGCTCCCTTTGTGGGCTTGGTGTTGGCGCTCTGGTTCCCC
GGGGTAGGGAACCTTGCTGGGTCCTTCCTGAGCCCCCATTCTCCCCTTGTGTCTTCTGTC
TTTCAGTGAGCTCTTCAGCCCAGGTGGGCCCCCTGACATTGATGCACATAGGTGAGTGCA
TTTTGCTGGCGTTATGGGCCATGAGTCAGGCCGCGTGGTGTCACTGAGGGTCAGCCCTCG
GGAAAGAAGGGTTTCTTCAGGGAGCCGACCTGAATCCCCACTGAGGAGGGATGGTTTCTC
CAGGAGTTTGGCTTCCTTGGGAATCAGACCCAAGATGATGCCTTCCTTGAAGCCCTTCAG
GGGTGACAGTGGTCCAGGCAGGAAAGGGTCCCCTCAGTCCCATGTAGGGCAGCTCCCAGC
TGAGACTCAGTGTTCGGGTCTGGCCTCAAGGACGGCCCAGGCCACATGAGGGGGGTCACA
GGGGCTCTGGGGTGCCACAGGGGTCACATGAGAGCTCTCTTTCCCTGGAGAGGGGTGCTT
GAATGGGCCCATGTGGTCAGGCCACAGAGATTTCAAGGATCGCACCCCAACCATGGCCTT
AAATGGGACCGACCCTGTTGAGTAATGGGCCTTCTCAATGGTGCCTCTTTGAGCTTGGTG
GGGGGCAGTGTTGTTTCCCTGGGTTTGGGTCAAGACTGAGCTCTGGCCAGCCCCTGGTGA
TGCTGCAGGCCAGCCCTTGAACTTATGGGCTTTGGTCCAAGTCGGCAGCCCATGTCTTAC
TGAAGGTTACCCTTTGCGTGTTGGTGAGTGGCTGGAGGAGTGGATCCTGAGGTGGGAAGA
CCTGCTGTCGATGGTCCTGTCCCGGGAATTTGCCACCCAGGCCTTTTCTGAGCCATGGGG
TCAATTCCAGCATGGCAGAGTCTTGGGCCTAAGGAAAGAGAGGACACAATGTGGCCCAGG
TTTGGCCGAGGGTGGCCTGACTGTTTTGAGGACCCGTGCGGGACATGGATGGGGACCTAC
CAGAGAAAGCTTGTGGCCCTGGGACTCCAGGCTTTGATTTCAAGTGTGACTTGCAAAGAG
AGCCTGGGCAGATGCCCACCATGCCAGGGGCAGGCTTTGCAACTTCCTTGTCTACAGTGG
CACATGGCTTCTGGGCCAGCCTCCTAGATTGGCCATGAGCTGGTTGGTAACCCTGGTCCG
TGCCCCATAGTCCCAGGGTGGCTCTGGGATCGTGCAGGATAGCTAGCATGGGCAGTGGAG
ATGCTATCAAGGCCTGCAGTAGGGCATAGTCAGGACATCTTACCTGAGCCCAGTGACCCA
CGTAACCTGTTTTTTCAGGGTTTGGTGATGGGGAGGGTCAAGGGTGCCCCACGTCCGTGA
TAGGTCTGTGTTCCTCATGGATCCCATCACATGGGTATCCCTCACCCCTACCCTGCATGG
AGGCGTGAGGCCCCGTTTGGACACATGTCCTCCTCCTGTCCCCCCAGATGGTGAGCCTGG
AGGAAGACTTGTGTTGGGCTCAATGTTCAGGCCAGTGGCCCAAAGCCATGTGCCCGGCCC
CTGGTGTGCTGAAGCTCGGGACCTTCCTAGTGACCTGGTCTCCTGCACTGACCTGTGATA
TGTACATCTGGGTCCCGCTGGATGCCTGCACAGGAAGTGGGGTGCCCTGGGTTGGGTCGA
TGATGAGAACCGTATATTGTCCTGAAGAGGGGTGATGACTTAAAAATCATGCTCAATAGG
ATTACGCTGAAGCCCAGCCTAGGTGAGAATTTTGGAAGATGGTGGAATCCCGAAGTCCCC
GGCAGGGCCCCTGTATTTTGGGCTGGAGACCTGGAGGGCCTAAAGGGCATCTGGGGGGCC
CAACCCTGTCTTTGCCCTCTTCTGTAAGGCAGCCCAGGCCCCCCATGCTGACTTGCTGTT
GGTGGTCCAGTTCCTTGGGTGGGGCATGAGGGCAGCTCCTCCCTGAGCCCCCCTTCTCCA
CTTGTGTCTTTCAGTGAGCTCTTCCACCCAGGCAGGGCACCCTCGCATTGAGTGGCATAG
GTGAGTGGATCCTACTGGCCTCATGGGCCATGGGCNNNNNNNNNNGCCTTCCCTGTCCTT
TCAAGGACTGGTGGCTGAGAGAGCACAGGGTGCCGTGCGTCTGTGACAGGCCAGTGTTCC
ACATGGATCCCATCACATGGGTCCATGGAAGGCGAGCATCCCTGAGCCGCCACACCCCAC
CTTCTGCCTCCATGGAGGGGTGAGGTTGTGTTTGGATGCCTGTCCTACTCCTGTTTCCCC
AGATGTTGAGCCTTGAGGAAGACTTGCATTGGACCCATTGGCCCCAGGCCAGCGTCTGTC
AGCCAGGGGCCCATCCCCTGGTGCACTGAAGATGGGGCCCTTCCTGGTGCCCTCGTCTCC
TGCATTGAGCTGTGGTGAGCACATCCAGGTCCCACTAGATGCATGCGTGGGCAGGGGGGT
GCCCTGGGTTGGGTTAATGATGAGAACCTTATATTGTCTGAAGAGAGGTGCTGACTTAAA
AATCATGCTCAAAAGGATTATCCTGAGGCCTGGCCTAGGTTAGAATTTTGGAAGACGATG
CTGGAGTTATGACTTCCCCAGCAGGACTACTGTATTTTGGGCTGGAGACCTGGAGGCTCT
GAGGGCATCTGGAGGGTGCCCAACCCTGTCTCTGCGCTCCTCCGTGAGGCAGCCCAGGCT
CACTATGTAGGCTTGGTGTTGGCACTCTTGTTACCCGGGGGGGGGGGGGCATTTTGGCGG
CTGCTTTCTGAGCCCGCAATCTCCCCTGTGTCTTTCAGTGAGCTCTTCTGCCCAGCAGCC
TCCCTGGCAGTGACCAGCATAGGTGAATGGATCCTGCTGGGGTAATGGCCTATGAGCCAG
GCTGTGTGGGGTCACCAAGCATCAGCCTTCAGCCATAAGAATTTCCTCAGGAGCTGACCC
GAATGCCCACCTGGGATGGGTTCTCCAGAATAGTGGCTTCCTTGGAAATCATACCCAAGG
AAGATACCTTCCCTGAAGCCCTGCAGGGGTTGCAGTGGTCCAGGCAGTAAAGGGTTTTCT
CAACCTCATGCAGGGCAGTGCCCCACTGAGACTCAGTGCTCAGGTCAGGCCTCTAGGATG
GCCAGGCCACATGAGGGGGGCCACAAGGGCTCTGGGGCACCAAGGGGTTCTTGCAGGGGC
TCTTCAACCTTGGAGAGGTGTGTGTAATTCAGCCCATGAGGTCAGGTCGTGGATTTTCAA
GGATTGCACCAAACCCATGGCCCTGAATGGGACAAACCCTAATAAGTTATGGGCCATCCC
AGTGGTGCCTCTTTGAGCCAAGTGTGGGGTGGCACTGTTTCCTAAGGGTGAGTCGAGACT
AGCTCTGGCCGGCACCTGATGGTGGTGCAATCCTGCGCTGGGATTGGTGGGCTTTGGGAC
ATGGGTACAGCCCATGTCCCATTGAGGTCACCCCTTCATTGTGGACAGGTGGTGAGAAGC
ATGTCCTCCTGAGGTGGGAAGGCCTGCTGTGGAAGACCCTGTCTCAGAAATTTGCTGTCT
TGGCTGCTTCTGAGCTATGGCGTCACCTCTGTGGTGGCGGGGTCTCGGGTGAATGAATCC
TGCTGGGGTCATGGGCCATGAGCCAGGCCGGGGTGGGGTCCCTGAGCGTCACCTTTTGGG
TCATGAGGGTTTCCTAAGGGAGCCGACCTGAATCCCCACCAGGGATGAATGGTTTCTCTG
GGAAGCAGGTTTCCTTGGAAATCAGTCCCAAGAAGGACACCTTCCCTGAAACCTTGCAGG
GGTAACAGAGGTCCAGGCAAGAGAGGGTTCTTTCAACCCAACGCAGTGCAGATCCTAGCT
GAGACTTGGTGCACAGGTGAGTCCTGGAGGACTGCCCAGGCCACATGAGGGCATCCACAG
GGTCTCCGTGGCCAGGAGTCTTATACGGGAGCCCTCTGTCCCCGAGGCTTGCAGAGGGGT
TGGGTGTGGGTGATCTGGCTTACGGAGTCAGGCCGTGAACATTCAAGGGTCGGGAACCAC
CCATGGCCCTGAATGGGACCGACCCTGTTGAGCAATGGCCATCCCGGTGGTGGCACCTTG
AGCCTGGTGGGGGTGGCGCTGCCTCAATGGGGTTGGGTCAAGGCTGAGCTCTGCCTGCCA
CCTTGTGGTTGGCCCTGGGAACCATGGGCTTTGGGCCAAGGGTGCAGCCTGCGTCCCGCT
TGAGGTCACTCCTACCTGAAGTGGAGTGGCCGGAAGGGTGGCATCCTGTGGTGGGAGACC
CACGGTCAAGGATCCTGTGCTGGCAATTTGCTGCGCAGGCTGGTTCTGAGTCATGGGGTC
ACCTCCAGGGTGACAGGGTCTTTGGCCAAAGGAAAGGAGAGGACATTATGTGGCCCCTGA
TTGGCCAAGCGTGGCCCAGCTCTGTTTGGGAGGTATGCGGTGCCTGAATGGGGACCCACC
AGAGAAGGCACGTGGCCCTGGGGCCCCAGGATGGTATTTCTGGTGTGAGCTTATAAAGGG
TGCATGGATGGGTGCATTCCATGCCCAGTGGCAGGTTATGTGACTGCCAGGTCTGCAGTG
GCACATGGGGTCCAGGCCAGCCTCCTTGGTTTGCCATGAGCTGGTTGGTGGCCCAGGCCC
TGCCTAGTGGTCTCATTGCAGCCCAGAGTCATGTGGGGGAGCTGGCGTGGGCAGTGGAGG
TGCTCCAGGGTCCTACAGTAGGGTGCAGCCTGGGCGTCTTGCTGGAATCCCATGACCCGC
CTGCCCTATCCTTCCAGGGTTGAGTGGCAGGGAGGGCCAAGGGTTCCTCATGTGCATGAC
CGTCACTGTTTTACATGGATCTCATCTCATGAGTCCATGGTGGGAGAGCATGTGTGAGCC
AGCACACCCTACCCACTTTGCCCTATGGAGGCACAAGGCCCTGTTTGGACACCTGTCCCC
CACCCCTCCAGATGCTGACCCTGGAGGAAGAATTGCACTGGGCCCACTGGCCCCGGGCAA
ATGTCCCTCAGCCAGGTGCTTAGCCCCTGGTAAGCTGAAGCTCAGGCCCTTCCTGATGCC
CTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCTGGGTCCCAATGGATGCATGCATGCG
TTGGGGGGTGGTGGTGTCCTGGGTTGGGTCGATGATGAGAAACTTATATTGTCTGAAGAG
AGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAA
TTTTGGAAGAGGATGCTGGGATTTCTAGGTCCCAGTCATGGGCACTGTATTTTGGACTGG
AGACCTGCGGGCCCTGAACAGCATCTCGGGGGGGACTCTACCCTGTCTCCACATTACATG
TGAGGCAGCCCAGGCTCCCTTTGTGGGCTTGGTGTCTGCACTCTGGTTCCCTGTGGTAGG
GCAGCTTGCTGGGTCCTTCCTGAGCCCCTGTTCTCCCTTTGTGTCTTCTGTCTTTCAGTG
AGCTCTTCAGCCCAGGTGGGCTCCCTGACACTGATGCGCATAGGTGAGTGGATTCTGCTG
GCATCATGGGCCATGAGCCAAGCTGCGTAGGGTCACCAAAGGTCACTCTTTAGGCCACGT
GGGTTTCCTCAGGGAGCCGACCTGAATCCCCACCAGGTTGGGACAGTTTCTCCAGGAGGC
TGGCTTCCTTGGGAATCAGACCCAAGACAATGCCTTCCCTGAAGCCTTACAGGGGTAACA
GTCGTCCAGACAGGAAAGGGTCCCCTCAGTCCCATGGAGGGCAGCTCCCAGCTGAGACTC
AGTGTGCGAGTCTGGCCTCAAGGATGGCCCAGGCCACATGAAGGAGGCCACAGGGGCTCT
GGGGTGCCACAGGGGTCACACGAGAGCTCTCTTTCCCTGGAGTGGGGTGCTCGAATGAGC
CCATGGGGTCAGGCTGCAGAGATTCAAGGATCGCATCCCAACCGTGGCCCTAAATACGAC
CGACCATGTTGAGTAGTGGGCCATCTCAGTGGGGCCTCTTTGAGCCTGGTGGGGGGCGGG
GCTGTTTCCCTGGGTTTGGGTCAAGGCTGAGCTCTGGCCAGGGCCTGGTGATGCTGCTGG
CCAGCCCAGGTTCTTGTGGGCGTTGGTCCATTCGGCAGCCCTGTCCTGCTGGAGGTCACC
CCTTGCCTGTTGGTGATTGGCTGGATCCTGAGGTGGAAAGACCTGCTGTTGATGGTCCTG
TCCCAGGAATTTACCACCCAGGCTGCTTCTGAGCCATGGGGTCACCTCCAGGGTGGCAGA
GTCTTGGGGCTAAGAAAAAAGAGGACACTATGTAGCCCACGGTTGGCCAAGGGTGGCCTG
ACTCTGTGTTTGGGACATGTGCGGGGCATGGATAGGGACCCGCCAGAGAAAGCACATGGC
CCGGGGACTCCAGGCTTCGATTTCAGGTGTGGCTTGCAAATAGCACCTAGGCAGGTGCCC
ACCACGCCCTGGGGCAGGCTATGCAACTTCCATCTCCACAGCGGCACATGGTTTCTGGGC
CATTCTCCTTGGTTGGCCATGAGCTGATTGGTTCCCCTGGCCTGTGCCCTGTGGTCCCGG
AGTGGCTCTGGGATCGTGTGGGGCAGCCAGCATGGACAGTGGAGATGCTATCAAGGCCTT
CAGTAGGGTGCAGCCCAGGTTTCTTGCCTGAACCCAGTGACCCACCTACCCTGTGTTTTC
AGGGTTTGCTGACAGGGAAGGCCAAACGTGCCCCACGTCCATGCTAGGTCAGTGTTCCTC
ATGGACCCCATCACATGGGTATCCCTTACCCCTTCCCCACATGGAAGTATGAGGCTCTGT
TTGGACACATGTCCTCTTCCTGTCCCCCCAGATGGTGAGCCTGGAGGAAAACTTGCATTG
GGCCCAATGGACCCAGGCCAGTGGCCATCAGCCAGGTGCCCACCCTGGTGTGCTGAAGCT
CGGGACCTACCTGTTGTCCTGGTTTCCTACACTGAGCTGAGGTGAGCACATCCGGGTCCC
TCTGGATGCATGCATGGGGCGGGGGGTGCCCTGGTTTGGGTCAATGATGAGAACCTTATA
TTATCCTGAAGAGAGGTGATGACTTAAATATCATGCTCAATAGGATTACGCTGAGGCCCA
GCCTAGGTGAGAATTTGGAAGAAGATGCTGGGATCCCGAAGTCCCAGTAGGGGACTTTAT
TTATTTATTTTGGGCTGGAGCCCTGGAGGCCCTGAAGGGCATCTGGGGGGCCCAGCCCTT
TCTCTGTGCTCCTCCGTGAGGCAGCCCAGCCTCCCTGTGTGGGCTTGCTGTTGGTGGTCC
AGTTCCTTGGGGCGGGGCACGTGGACAGCTCCTCCTTGAGCCCCCCTTCTCCACTTGTGT
CTTTCAGTGAGCTCTTCAACCCAGGCGGGGCACCCTGGCATTCACCAGCATAGGTGAGTG
GATCCTGCTGCCATCGTGGGCCATGGGCCAGGCTGGGTAGAGTCACTGAGGGTCAGCCTT
CGGGACAGGAGAGTTTCCTCAGGGAGCGAACCTGAATCCCCACCGGGGAGGGATAGGTTG
GTCCTCCAGGAGGGTGGCTTCCTGAGAAATCGGACCCAAGGGGGATGCCTTCCCTGGAGC
CCTGCAGGGATGACGGTGGTCCAGGCAGGAGAGGGTTCCTTCAGTCTCACACATAGTAGC
TCCCAGCTGAGTCTAGGTGTTCGAGTCTGGCCTTGAGGACTGCCCAGGCCACCTGAGGGG
CCAACAGGGGCTCTGGGACACCATGGGGGTCACATAGGAGCTCTCCATTCATGGAGAAAG
ATGGATGATAGGGCCGATGGAGTCGAGCTGTGGAGATTTAAGGATTGCGCCCAATGTATG
GCCCTGAATGGGACAGAGCCTGTTGAGTAATGAGCAATTCTATGGGCCTCATCGAGCCTT
GAGCAGGGCGGTGCTGTTTCCCTATGTTTGGGTCAAGGCTGGACTCTGGCCGGTGCCTGG
TGGTGCTGAGGTCTGGCCATGGACTCGTTGGCTTTGGGCCAAGGGGTCAGCCTGCTCCCC
CTGGAAGTCCCCCCTTCCCCGTGGCTGGAAGTCATCCCTTCCCAAGGAGCAAGTGTCGGG
AATGGTTGCCTCCTGAGGTTGCAAGGCCTGTTATCTAGGGTCTTGTCCTTGGAATATGCT
GCCCATGCTGCTTCTGAGTCATAGGGTCACCTCCAGGGTAGCGGATCTTGGGCCCAGGGA
CAGGAGAAGATGGCGTGTGTCCCCTGATTAGCTGATTGTAGCCCTGCTCTGTGTTCAGGA
GGTGTGTGGGGCATGGATGCAGACCCACCAGAGAAAACTGTGGCCCTTAGACCCCAGGTT
GCAATTTCCATTATGTGCTGGGATAGGGCATCTGGGTGGGCACCCACTATGCACAGAGAT
AGGCTATGTGACTGCCAGGGCTGTAGCGGCATCTGACATCTAGGCCAGCTTCCTTGGTTT
CCTGCGAATGAGTTGGTGGCCCTGGCCTGTGGCTAGTAGTCCTGGGGTGACCCCGGGTTG
TGTTGGGGAGCCAGCAGGGGCCCAGTGACCAACCTGCCCTGTCCTTCCAGAGTTCTGTGG
CTAAGAGAGCACTGGGTACCCTGTGTCCGTGATGGGCCAGTGTTCCACATGCAAACGATC
ACATGGGTCCATGGAGGGCAAGCATACTTGAACTGCCACACCCCACCTTCTGCTCACATA
CAGGAGTGAGGTTGTGTTTGGACAGCTGTCCTACTCCTGTTCCCCTAGACCGTGAAATGG
GAGGAAGAATTGTGTTGGGCCCAATGGCCCTGGGCCAGTATCCGTCAGCCTGGTGTCCAG
CCCCTGGTGTGCTGAAGCGCATGCCCTTCCTGGTGCCCTAGTTTCCTGCACTGAGCTTGG
TGAGCCCATTTGGGTACTGCTGGATGCTTGGGCGGGGAGGAAGGTGCCCTGGGTTGGGTC
GCTGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATTCTCAAAA
GGATTATGCTGAAGCCCACCCTAGGTGACAATTTTGGAAGAGGACACTGGAAATCAATGA
GGTCCCTGGCAGGGCCGCTATAATTTGGGGTGGAGACCTGGAAGCCCTGAAGGGCACCTC
GTGGGGGCCCAACCCTGTCTCTTCACTCCCCTGTGAGGCAGCCCAAGCTCCCTGTGTAGG
CTTGGTGTCGGCACTCTGCTTTCCTGGAGGCGGGACATTTTGGCTGCTCCTTCCTGAGCG
CCTGTTCTCCCCTGTGTCTTTCAGTGAGCTCTTTTGCCCAGCAGACTCCCTGGCATTGAT
TGGCATAGGTGAGTGTCTCCTGCTTGGGTCATGGGCCATGAGCCAGACCATAGGGTTGCC
GAGGGTCAGCATTTGAGCCATGAGGGTTTCCTCAGGAGGCGACCTGAATCCCCACCTGGG
ATGGGTTCTCCAGGAGGGCAGCTTCCTTGTGAATCTGAGCCAAGTAGGATGCCTTCTCTG
AAGCCCTGCAGGGTTGCCAGTTGTGCAGGCAAGAAAGGGTTCCCTCAGCCCCAGGCAGGG
CATCGCCCAGCAGAGACTCGGTGGTTGGGTTAGGCCTCTAGGATGACCAGGCCACATGAG
GGGGGCCGCAAGGGCTCTGGGGCACAACAGGGTCCTCGCAGGGTCTCTCCGACCCCGAAG
AGTGGTGGGCGATTCGGCCCATGTGGTCACTGTTTCACATGGATCCCATCACATGGGTCC
ATGGAGGGAGAGCATGTGTGAGCAGGCACCCCTTGCTTCCTTTCCCACATGAGCCCCTGC
TTGGACACATGTCCTCCTCCTGTCCCCCCAGATGGTGGCCCTGGAGGAGGACTTGTATTG
GGGTCACTGGCCCCACATCAGTGTCCATCAGCCCGGCATCCAGCCCCTGGTGTGCTGAAG
CTCAGGCCCTTCCTGTTGCCCTAGTCTCCTGCACTGAGCTTGGTGAGCCCATTCGGGTAC
TGCTGGATGCATTGGCGGGGAGGGATGTGCCCTGGGTTGGGTCGATGATGAGAACCTTAT
ATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATTCTCAAAAGGATTATGCTGAGGCCC
GGCCTAGGTTAGAATTTTGGAAGAGGATGCTGGGATCCCGAGGTCCCCAGGAGAGCCCCT
TTATTTTTGGCTGGAGACCTGGAGGCCCTGAAGGGTATCTGGGGGGCCCAACCCTGTCCC
TATACTCCTCTGTGAGGCAGCCCAGGCCCTCTGTGCGGGCTTGGTGTTGGCACTCTGGTT
TTCTGGGGGCGGGTCAGGTTGGTGGTTCCTTCCTGAACCATTGTTCTCCCCTTGATTCTT
TCAGTGAGCTCTTCTCTCAGGCGGGTCCCCTGGCATTGACCAGCTTAGGTGAGTGGATCC
TGCTGGGTTCATGGGCCATGAGCCAGACACATGGGTTGACTGAGGGTCAGCCTTCAGGAC
AGGAAGGTTTCCTCGGGGAGCCAACCTGAATCCCCACCGGGGAGGGATTTGTTAGTCCTC
TAGGAGGGTGGCTTCCTGGGGATTCTCACTCCAGGAGGACACCTTCACTGAAGCCCTGCA
GGGGTGATGGTGGTCCAGGCTGGAAAGTTTTCCTTCAGTCTCATGTGGGGCAGCTCCCTG
CTGACATTCGGTGCCTGCATCTGACCTCGAGGACTGCCCAGGTCACATGAGTGGGGCAAC
AAGGGCTCCAGGGTGCCATGGGGATTATGTGGGGTCTCTCTGTTCCCGCAGAGAGGTGGG
CGATCTGGCCCATGGGGTCAGGCTTGTAGGGTTCGGTGGCGGGGAGAGCCAAGGGTTCCC
TGGATCCATTACCATCACTTCTTCACATGGATCAAATCACATGGTCCATGGAGGGAGAGC
ATGTGTGAGCCGACACCCCTTGCTCCCTTTCCCCCATGGAGATGTGAGGCCCTGTTTGGA
CACCTGACCCCCGTCCCTCCAGATAGTGAAACTGGAGGAAGACTCTTCTTGGGTCCCCTG
GCCCCAAGCTAAAGTCCATCAGCCAGATGCCAGACCCTGGTGCACTGAAGCTCGTGCCCT
TCCTGGTGCCCTGGTCTCCTTCACTGAGCTGTGGTGAGAACATCCAGGTCCTGCTGGATG
CATGCATGGGGAGGAATGTGCCCTGGATTGGGTCAATGATGAGAACCTTATATTGTCCTG
AAGAAAGGTGATGACTTAAAAATCATGCTCAATAGGATTATGCTGAGGCCCACCCTAGGT
GACAATTTTGGAAGAGGACACTGGAAATCAATGAGGTCCCTGGCAGGGCCACTGTAATTT
GTGGTGGAGACCTGGAAGCCCTGAAGGGCACCTCATGGGGTCCCAATCCTGTCTCTTCAC
TCCCCCGTGAGGCAGCCCAAGCTCCCTGTGTGTGCTTGGTGTACGCGCTCTGCTTTCCTG
GAGGCGGGACATTTTGGCTGCTCCTTCCTGAGCCCCTGTTCTCCCCTGTGTCTTTCAGTG
AGCTCTTTTGCCCAGCAGAATCCCTGGCATGGACCGGCATAGGTGAGTGTCTCCTGCTTG
GGTCATGGGCCGTGAGCCAGACCATAGGGTTGCCGAGGGTCAGCATTTGAGCCATGAGGG
TTTCCTCAGGAGGCGACCTGAATCCCCACCTGGGATGGGTTCTCCAGGAGGGCAGCTTCC
TTGTGAATCTGAGCCAAGTAAGATACCTTCTCTGAAGCCCTGCAGGGTTGCCAGTTGTGC
AGGCAAGAAAGGGTTCCCTCAGCCCCAGGCAGGGCATCGCCCAGCAGAGACTCGGTGGTT
GGGTTAGGCCTCTAGGATGGCCAGGCCACATGAGGGGGGCCACAAGGGCTCTGGGGCACC
ACAGGGGCCTCACAGGGTCTCTCCGACCCCGAAGAGTGGTGGGCGATTCGGCCCATGTGG
TCACTGTTTCACATGGATCCCATCACATGGGTCCATGGAGGGAGAGCATGTGTGAGCAGG
CACCCCTTGCTTCCTTTCCCACATGAGCCCCTGCTTGGACACATGTCCTCCTCCTGTCCC
CCCAGATGGTGGCCCTGGAGGAGGACTTGTATTGGGGCCACTGGCCCCATGTCAGTGTCC
GCCAGCCTGGCATCCAGCCCCTGGAGTGCTGAAGCTCAGGCCCTTCCTGTTGCCCTAGTC
TCCTGCACTGAGCTTGGTGAGCCCATTCGGGTACTGCTGGATGCATGGGCGGGGAGGGAT
GTGCCCTGGGTTGGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTT
AAAAATCATTCTCAAAAGGATTATGCTGAGGCCTGGCCTAGGTTAGAAATTTGGAAGACG
ATGCTTGGATCCTGAGATCCCCAGCCAGGCCACTCTATTTTTGGCTGGAGTCCTTGAGAC
CCTGAAGGGCGTCTCAGGGCTGCTGAATGCTGTCTCTGCGCTTGTCCATGAGGCAACCCA
CTTTCACCTTGTGGGCTTGGTGTTGGCCTTCCGGTTCTCCGGGGACGCGGCATATTGTCA
GCTTGTCCCTGAGTACCCGTTCTCCCCTGTGTCTTTCAGTGAGCTCTTCTGCCCAGGTGG
TTCCCCTGGTCTTGATGGGCATAGGTGAGTACATCCTGCTGGCATCCTGGTCCATGAGCC
AGGGTGCGTACGGTTGCCGGAGGTCACCCTTTAGGCCATGTGGGTTTCCTCAGGGAGCTG
ACCTGAATCCCCACTGGGAGGGATGGTTTCTCCAGGAGGGTGTCTTCCATAGAAACTGGT
TCCAAGAAGGATGCCTTCCCTGAAGCTGTGCAGGGGTGACGGTGGTCCAGGCAGGAAAGG
GTCCATTCAACCCAATGCAGTACAGCTTCTAGCTGAGACTCAGTGCACGGGTGAGGGCTT
GAGGACTCCCAGGCAACATGAGGGGTTCCACAGGATCTCCGGAGGCCACAGGTGTTAAGC
AGGAACTCTCCATCCTTGAGGCTTGCTGGGGGTGGTGGGATGGCAGCAGGGTGTGGGTGA
TCGAGTTTATGGATTCAGGCCAAGATTCAAGGGTCAGGCGCCATCCATTGCCCTGATGGG
ACCAACCCTGTTGTGCAATGGGCTGTCCCACTGGTGCCTCCTTGAGCCTGGTGTGGGCAG
CGTGGCTTCAATGGGGTTGGGTCAAGGCTGAGCTCTGGCCCGCACCTGGTGGTTGGCCCT
GGGAATTGTGGACTTTGGGCCAAGGGTGCAGCCCGCCTGCCTCTGGAGGTCATCCTACCC
AGAGGTGGAGTGGCCGGAAGGGTGGCAGGCATCCTGTGGTAAAAGGCCAACTGTTGAGGG
TCCCGTCCCACCAATTTGCTGTCCAGGCTGCTTCTGAGCCATGGGTTCACCTCCAGGGAA
GCGAGATCTTGAGCCCAGGGAAAGGAGAGGACATCATGTGTCCCCTGATTGGCTGAGAAT
GGGGAGAGTGTTTGGGTGGCATGTGGTGCATGAATGGGGACCCACCAGAGAAAGCACGTG
GCCCTGGGGCCCCAGGATGCGATTTCCAGCGTGCTTATAGAGGGCGTCTGAGTGGACCCT
CTCCATGCCCAGGCGCAGGCTATGTGACTGCCAGGTGTGCAGCAGTTCGTGGCATCCGGG
CTAGCCTCCTTGATTGCTTATGAGCTGGTTGATAGCCCTGGCCTGTGCCGAGGGGTCCTG
GTGCGGCCCTGGGGTTGTTCAGGGGAGCCGGCATGGGCAGTGGAGGTGCTCTTGGGGCCT
GCAGTAGGGCACAGCCCAGGTGTTCTTGCTTGAGCGCAGTGAACCACCTGCCCTTTCCTT
CCAGGGTTCGGTAGCAGGGAGGGCCAAGGGTCCCCCGCGTCCATAACAGGTCAGTGTGCC
ACATGGATCCCATCACATGGGTACATGGAGGGAGAGCATGTGTGAGCCGGCACTCCCCAC
TCTCTTCCCCGCATTGCAGGGTGAGGCCCTGTTTGGACCCGTCCTCCAGCTATCTCACCA
GATGGTGAGCCCAGAGGAAGACCCCCTGGCCCTGGGCTAGTATCCATCAGCCAGGTCCCC
AGCCCCCAGTGCGCTGAAGCTCAGGCCCTTCCCAACGCCCTGGTCTCCTGCACTGAGGTG
TGGTGAGCACATCCGGGTCCCAGTGGATGCATGCACAGGGAGGGATGTGCCCTAGGTTGT
GTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATTCTCA
AAAGGATTATGCTGAGGACTGGCCTAGTTTAGAATTTTGGAAGAGGATGCTGGGATCCCG
AGGTCTCCAGGAGAGCCCCTGTATTTTTGGCTGGAGACCTGGAGGCCCTGAAGGATATCT
GGGGGGCCCAACCCTGTCCCTATACTCCTCTGTGAGGCAGCCCAGGCTCTCTGTGCGGGC
TTGGTGTTGGCACTCTGCTTTTCTGGGGGCGGGTCAGGTTGCTGGTTCCTTCCTGAACCA
TTGTTCTTCCCTTGATTCTTTCAGTGAGCTCTTCTCTCAGGCGGGTCCCCTGGCATTGAC
CAGCATAGGTGAGTGGATCCTGCTGGGTTCATGGGCCATGAGCCAGACACATGGGGTGAC
TGAGGGTCAGCCTTCGGGACAGGAAGATTTCCTCAGGGAGCCAACCTGAATCCCCTCCGT
GGAGGGATGTGTTGGTCCTCCAGGAGGGTGGCTTCCTGGGGAATCTGACCCCAGGAGGAC
ACCTTTGCTGAAGCCCTGCAGGGGTGATGGTGTTCCAGGCCGGAAACGTTTCCTTCAGTC
TCATGTGGGGCAGCTCCCTGCTGACATTCGGTGCCTGCATCTGACCTCGAGGACTGCCCG
GGCCACATGAGTGGGGCAACAAGGGCTCCAGGGTGTCACAGGGATTATGAGGGGGACTCT
CCATCCCCGGAGAGAGGTGGGCGATCTGGCCCATGGGGTCAGGCTTGTAGGGTTCAGTGG
CAGGGAGAGCCAAGGTTTCCCTGGGTCTATTACCGTCACTGTTTCACATGGGTCCCATCA
CATGGGTCAATGGAAGGAGGACATGTGTGAGCAAGCACCCCTTGCTCCCTTTTCCACATG
GAGATGTGAGGCCCTGTTTGGACACCTGACCCCCGTCCCTCCAGATAGTGAACCTGGAGG
AAGACTCTTCTTGGGTCCCCTGGCCCCAAGCCAGTGTCCGTCAGCCAGATGCCAGAACCC
CGTGCACTGAAGCTCGTGCCCTTCCTGGCGCCCTGGTCTCCTGCACTGAGCTGTGGTGAG
AACATCCGGGTCCTTCTGGATGCATGTGTGGGGAGGAATGTGCCCTGGATTGGGTCAATG
ATGAGAACTTTATATTGTCCTGAAGAAAGGTGATGACTTAAAAATCATGCTCAATAGGAT
TACGCTGAGGCCCACCCTAGGTGACAATTTTGGAAGAGGACACTGGGAATCAATGAGGTC
CCTGGCAGGGCCACTGTAATTTGGGGTGGAGACCTGGAAGCCCTGAAGGGTATCTCGTGG
GGGCCCAACCCTGTCTCTTCACTCCCCCTTGAGGCAGCCCAAGCTCCCTGTGTGTGCTTG
GTGTCGGCACTCTGCTTTCCTGGAGGCAGGGCATTTTGGCTGCTCCTTCCTGAGCCCCTG
TTCTCCCCTGTGTCTTTCAGTGAGCTCTTTTGCCCAGCAGACTCCCTGGCATTGATCGGC
ATAGGTGAGTGTCTCCTGCTTGGTTCGTGGGCCATGAGCCAGACCATAGGGTTGCCGAGG
GTCAGCCTTTGAGCCATGAGGGTTTCCTCAGGAGGCGACCTGAATCCCCATCGGGGATGG
GTTTCCTCAGGAGGCGACCTGAATCCCCATCGGGGATGGGTTCTCCAGGAGGGCAGCTTC
CTTGTGTATCTGAGCCAAGTAAGATGCCTTCTCTGAAGCCCTGCAGGGTTGCCAGTTGTG
CAGGCAAGAAAGGGTTCCCTCAGCCCCAGGCAGGGCATCGCCCAGCAGAGACTCGGTGGT
TGGGTTAGGCCTCTAGGATGGCCAGGCCACATGAGGGTGGCCACAAGGGCTCTGGGGCAC
AACAGGGGCCTCGCAGGGTCTCTGCGACCCCAAAGAGTGGTGGGCGATTCGGCCCACGGG
ATCGGGCCCCAGATTCAAATATCACACCACACCCATGGCCCTGAATGGAACCGACCCTGT
TAAGCATTGGGGCATCCCAGGGGTGCCACTTTGAACCGGGTGTGGGATGCCGCTGTTTGC
CTGAGGTTGGGTCGAGACTAGCTCCGGCCAGCACCTGATGGTGGTGCAGTCCGGCCCTGA
GATTAGTGGGCTGTGGGCCCAGGGTGCAGCCTGTGTCCCGCTGGGGGTCACCTCTTCCTT
GTGGGCGAGTGGTGGAAGGGCGTCCTCCTGAAATGGGAAGGCCCGCTGTGGAAGGAACTG
TCCTGGAAATTTGCCATCCAGGCTGCTTCTGAGCCATGGGGTCACCTCCAGAGTGGCAGG
GTCTTGGGCCCAAGGAAAGGAGAGGACACTGTTTCCCCAATTAGCTGAGTGTGGCCCTGC
TGTCTGTGTGGGAGGTGTTGTGTGGGGCATGGATAGGGACCCACCAGAGACAATACATGG
CCCTCGGGCCCCAGGCTGCAATTTCTCAGTGCATCCTTGGAGACGGTCCTGGGCCTCCTC
CACGCCCAGGGTCAGGCTGTACAACTGTCAGGTTAGCGGCGGCATGTGGTGTCTGGGCCT
GTCTACTTGGTTGTCCGTGAGCTGCTGGTGGCCCTGGCCCTTTCCCAGGGGTTCAGGTGC
AGCCCTGGGGTTGTGTGGGACAGCCAGTGTGGGCAGTGGAGCTGCTCTGGAGGCCTGCTT
TAGGGTGCAGCCTGGGTGTCTTGCCCGAGTGTAGTGACCCACCTGCGGTGTCCTCACGGG
GTTCCCTAGCAGGGAGGGCCAAGGGTCCCCTGTGTCTGTGACACATGAGTGTTTCCCATG
GGTCCCATCAAATGGGTCCACGGAGGGAGAGCATGAGTGAACTGGCACCCCCCACCCCCA
CCCTCTTCCCCACCTGGAGGCATGAGCCCCTGGTTGGACATATGTCCTCCTCCTGTACCC
CCAGATGGCAGCCCTGGAGGAGGACTTATACTGGGGCCGCTGGCCCCACATCAGTGTCCG
TCATCCCGGCGTCCAGCCCCTGGTGTGCTGAAGCTCAGGCCCTTCCTGTTGCCCTAGTCT
CCTGCACTGAGCTTGGTGAGCCCATTCGGATACTGCTGGATGCATGGGTCGGGAGGGAGG
TGCCCTGGGTTGGGTCGATGATGATATATTGTCCTGAAGAGAGGTGATGACTTAAAAATC
ATTCTCAAAAGGATTATGCTGAGGCCCGGCCTAGGTTAGAATTTTGGAAGAGGATGCTGG
GATCCCGAGGTCCCCAGGAGAGCCCCTTTATTTTTGGCTGGAGACCTGGAGGCCCTGAAG
GGTATCTGGGGGACCCAGCCCTGTCCCTATACTCCTCTGTGAGGCAGCCCAGGCTCTCTG
TGTGGGCTTGGTGTTGGCACTCTGGTTTTCTGGGGGCGGGTCAGGTTGGTGGTTCCTTCC
TGAACCATTGTTCTCCCCTTGATTCTTTCAGTGAGCTCTTCTGCTCAGGCGGGTCCCCTG
GCATTGACCAGCATAGGTGAGTGGATCCTGCTGGGTTCATGGGCCATGAGCCAGACCACA
TGGGGTGACTGAGGGTCAGCCTTCGGGACAGGAAGATTTCCTCGGGGAGCCAAACTGAAT
CCCCACCGTGGAGGGATGTGTTAGTCCTCCAGGAGGGTGGCGTCCTGGGGAATCTGACCC
CAGGAGGACACCTTTGCTGAAGCCCTGCAGGGGTGATGGTGGTCCAGGCTGGAAAGTTTT
CCTTCAGTCTCATGTGGGGCAGCTCCCTGCTGACATTCGGTGCCTGCGTCTGACCTTGAG
GACTGCCCGGGCCAAATGAGTGGGGCAACAAGGGCTCCAGGGTGCCACGGGGATTATGAG
TGGGACTCTCCATCCCCAGAGAGAGGTGGGCAATCAGGCCCATGTGGTCAGGCTTGTAGG
GTTCGGTGGTGGGGAGAGCCAAGGTTTCCCTGGGTCCATTACCGTCACTGTTTCACCTGG
ATCCCATCACATGGGTCCATGGAGGGAGAGCATGTGTGAACAGGCACCCCTTGCTCCCTT
TCCCACATGAGCCCCTGGTTGGACATATGTCCTCCTCCTGTCCCCCCAGATGGTGGCCCT
GGAGGAGGACTTATATTGGGGCCACTGGCCCCACGTCTGTGTTCATCAGCCCGGCATCCA
GCCCCTGGTGTGCTGAAGCTCAGGCCCTTCCTGTTGCCCTAGTCTCCTGCACTGAGCTTG
GTGAGTCCATTCGGGGACTGCTGGATGCATGGGCAGGTAGGGAGGTGCCCTGGGTTGGGT
CGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATTCTCAAA
AGGATTATGCTGAGGCCTGGCCTAGGTTAGAATTTTGGAAGAGGATGCTCGGATCCTGAG
ATCCCCAGCCAGGCCACTGTATTTTTGGCTGGAGTCCTTGAGGCCCTGAAGGGTGTCTGA
GGGCTGCTGAAACCTGTCTGTGTGCTTGTCCGTGAGGCAACCCACGTTCACTGTGTGGAC
TTGGTGTTGGCCTTCCCGTTCTCCGGGGATGGGACATACTGTCAGCTTGTCCCTGAGTAC
CCGTTCTCCCCTGTGTCTTTCAGTGAGCTCTTCTGCCCAGGTGGTTCCCCTGGTCTTGAT
GGGCATAGGTGAGTACATCCTGCTGGCATCCTGGTCCATGAGCCAGGGTGCGTACAGTTG
CCGGAGGTCACCTTTAGGCCATGTGGGTTTCCTCAGGGAGCTGACCTGAATCCCCACTGG
GAGGGATGGTTTCTCCAGGAGGGTGTCTTCCATAGAAACTGGTTCCAAGAAGGATGCCTT
CCCTGAAGCTGTGCAGGGGTGACGATGGTCCAGGCAGGAAAGGGTCCCTTCAACCCAATG
CAGTACAGCTTCTAGCTGAGACTCAGTGCACGGGTGAGGGCTTGAGGACTCCCAGGCAAC
ATGAGGGGTTCCACAGGATCTCCGGAGGCCACAGGTGTTAAGCAGGAACTCTCCATCCTT
GAGGCTTGCTGGGGGTGGTGGGATGGCAGCAGGGTGTGGGTGATCGAGTTTATGGATTCA
GGCCAAGATTCAAGGGTCAGGCCCCACCCATTGCCCTGATGGGACCAACCCTGTTGTGCA
ATGGGCTGTCCCACTGGTGCCTCCTTGGGCCTGGTGTGGGCAGCGTGGCTTCAATGGGGT
TGGGTCAAGGCTGAGCTCTGGCCCGCACCTGGTGGTTGGCCCTGGGAATTGTGGACTTTG
GGCCAAGGGTGCAGCCCGCCTGCCTCTGGAGGTCATCCTACCCAGAGGTGGAGTGGCCGG
AAGGGTGGCAGGCATCCTGTGGTGAAAGGCCCACTGTTGAGGGTCCTGTCCCACCAATTT
GCTGTCCAGGCTGCTTCTGAGCCATGGGTTCACCTCCAGGGAGGCGGGATCTTGAGCCCA
GGGAAAGGAGAGGACATCATGTGTCCCCTGATTGGCTGAGAATGTGGAGAGTGTTTGGGT
GGTATGTGGTGCATGAATGGGGACCCACCAGAGAAGGCTCGTGGCCCTGGGCCCCAGGAT
GCAATTTACAGCGTGCTTATAGAGGGCGTCTGAGTGGACCCTCTCCATGCCCAGGTGCAG
GCTATGTGACTGCCAGGTGTGCAGCAGTTCGTGGCATCCGGGCTAGCCTCCTTGATTGCT
TATGAGCTGGTTGATAGCCCTGGCCTGTGCCGAGGGGTCCTGGTGCGGCCCTGGGGTTGT
TCAGGGGAGCCGGCATGGGCAGTGGAGGTGCTCTTGGGGCCTGCAGTAGGGCACAGCCCA
GGTGTTCTTGCTTGAGCGCAGCGAACCACCTGCCCTTTCCTTCCAGGGTTCGGTAGCAGG
GAGGGCCAAGGGTTCCCCGCGTCCATGACAGGTCAGCGTTCCTCCTGGATCCCATCACAT
GGGTACATGGAGGGAGAGCATGTGTGAGCCGGCACTCCCCACTCTCTTCCCCGCATTGCA
GGGTGAGGCCCTGTTTGGACCCATCTTCCAGCTATCTCACCAGATGGTGAGCCCAGAGGA
AGACCCCATGGCTCTGGGCCAGTGTGCGTCAGCCAGGTCCCCAGCCCCCAGTGTGCTGAA
GCTCAGGCCCTTCCCAACGCCCTGGTCTCCTGCACTGAGGTGTGGTGAGCACATCCGGGT
CCCAGTGGATGCATGCACAGGGAGGGATGTGCCCTAGGTTGTGTCGATGATGAGAACCTC
ATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGC
CCAGTCTAGGTTAAAATTTTGGAAGAGGATGCTGGGATCCCAAGTTCACAGGCAGGGCCA
CTGTATTTTGGACTAGAGAACTCAAGGCCCTAAAGGGCATCTTGAGGGGGTCCAACCTGT
CTCTGTGCTCCTCCGTGAGGCAGCCCTGGCTCCCTGTGTGGCCTTGGTGTTGGCGCTCTG
GTTCCCGGGCGTGGCATGTGGGCACCTCCTTCCAGAGCCCCCATTCTCCCCTGTGTCTTT
CAGTGAGCTCTTCCGCCCATTTGGGCCCCCTGACATTGACCGGCATAGGTGAGTGGATCC
TCTTTGGGTCATGGGTCATGAGCGAGGCAAAGCGGGGTCACCATGCATCTGCCTTCGGGC
CATGAGAGTTTCCTAAAAGTGTGGACCTGAATTCCCACCGGGGATGAGTTATCCAGAAGG
GCCACTTCCTTGGGAATCGGACCCAAGAAGGACGCCTGTCCTGAAGCCCAGCAGGGGTGG
TGGTGGTCCAGGCAGGAAAGGGTTCATTCGACACCAAGCAGGCAGCTCCCATCTGAGACT
TGGTGCATCGGTCAGGCCTTGAGGACTGCCCAGGACACATGAGGTGGCCACAGGGGCTCC
GGGGCGCTACGGGGGGTCTACAGAGAGGGGTAGGCGATTGGGTCCTTGGGGGTCATGCCA
TGGAGTTTCAAGGACACCCATGGCCCTGAATGGGACTGACCCTGTTGAGCAATGGGCCAT
CCCAATGGCACCTCCTTGAGTCTGACGGTGGGTGGTGCTGTTTCCCTGGGGCTAGGTCAA
GGCTGAGCTCTGGCCAGTGCCTGTGGTGCTGCAGGCTGGCCCTAGAACTCATGGGCTTTG
GGCCATGGGGACAGCTTGTGTCATGCTTGGGGTCACCCCTTCCCGGAGGTTGAATGGCGG
GAGTGGTGGCTTCCTAAGGTGGGAAGTCCTGCTATTGAGCAACCTGTCCTGGGAATTTGC
CACCCAGGCTGCTTCTGAGACATGAGGTCACCTCCAGAGTGGCAGCATCTTGGGTCCAAG
GAAAGAGGAGCATAACATGTGTCCCCAGATTGGTTGAGTGTGGCCTAGCTCTGTGTTTGG
GAGGTGTGCAGGGTGTGGATGGGGATGTATCAAAGAAAGTACATAGCCCTGGAGCCCCAG
GCTGTGATTTCCAGTGTATGCTTGGGGAGGGGCAGGAGCAGGCTCTCGACTGCCAGGTCT
GCAGCAGCGCGTGGCATCCGGGCCAGCCTCCTGGTTGGCCATGTGCTGGTTGGTGGCCCT
GGCCTGTGCCCAGTGGTCTCAGGGTAGACCTGGCATTGTGCAGGGCAGCCAGCAGGGCAG
TGGAGGTGCTCTCAGGACCTGCAGTAGGGCGCAGCCTGGACTTTTTGCGTGAGACCAGTG
ACCCACCTGCACTGTCCTTCCAGGGTTGGGTGGCTGGGAGGGCCAAGGGTGGTCCATGTC
TGTCTCCGTGACACATCAGTGCTCCGCATGGATCCTATCACATGGATATCCCCTACCCAC
CTTCCCCACATGGAAGCATGAGGCCCTACTTGGACATGTGTCCTCCTGTCCTAGATGGTG
AGCTCGGAGGAAGACTTGCATTGGGCCCAATGGAGCTGGGCCAGTGTCTGTCAGCCAGGT
CCCCAGCTCCTGATGCGCTGAAGCTCAGGCCCTTCCTGGAGCCCTGGTCTCCTGCCCTGA
GCTGTGGTGAGCCCATCTGGGTCCCACTGGATGCATGCATGGGAGGGGGTTGCCCTCGGT
TGGGTAGATGATGAGAACCTTATATTTTCTGAAGAGAGGTGATGACTTAAAAATCATGCT
CAGTAGGATTACGCTGAGGCCCAACCTAGGGGTGAATTTTGGAAGAGGACGCTGGGATCC
TGAGGTCCCTGGCAGGGCCACCGTATTTTGGGCTGGAGACCTCAAGGCCCTGAAGGGCAT
CTTGGCAGCACCCAGCCCTGTCTCTGCACTCCTCGGTGAGGCAGCCCAGGCTCCCTGTGT
GGGCTTGGTGTCAGAGTCCCATTCCCCAGGGGCGGGGCAGGTTGGCGGCTCCTCCCTGAG
TCCCCTTTCTCCCTTGTGTCTTTGAGTGACTTCTTCTGCCCAGGTGGGCCCCCTGGCGTT
GACCAGCATAGGTGAGTGGAACCTGCTGGTGTCATGGGCCATGAGCCAGGCCATGTGGGG
ACTCCAGGTCAGCCTTCAGGACAGGAGAGTTTCCTCAGGGAGCAGGGGAATCCCCACTGG
GGAGGGATGGCTTCTCCCAGAGGGCCACTTTCTTTCAAATCGGACCCATGGAGGACATTT
TCTCTGAAGACCTGCAGAAGTGATGATGTTTCAAGCAGCAAAGGGTTTTTTCAGCCCCTG
CAGGGCAGGCAGCTCCCAGATGAGATTCTGTGCATGGGTCAGGCCTCAAGAACTGCCAAG
GCCACATGCGGGGTGCCACACAGGCTGTGAGGCACCACAGGGGTCATGCAAGAGCTCTCG
GTCTTCAGGCTTGTTGTGGGGGTGGTGACAGAGTGATCAGGCCCACAGGGTCAGGCTGCA
GTGTTTCAAGGATCGCGCCCACCCGTGGCCCTGAATGGGACCGATGCTTTTGAGCAATGA
GCCATCCCAGTGGCTCCACATTGAGCCTGGTGGGGGCGCCACTGTTTCAGTGGGGATGGA
TGAAGCTTGAGCTCTGGCCAGCACCTGATGGTGTTGCAGGCTGGCCCAGGGACTTGTGGG
CTTTGGGCCAGGTCGGCAGCCTGAGTTCTGCTGGGGGTCACATCTTTCCTGAGTTTCAGT
GTCAGGATGCATGTCCTCCTTAGGTGGGAAGGCCTGCTGTGGAGGGTCCTGTCCTGGGAG
TTTGCTCCCCAGGCTGCTTCTGAGCCATGGCGTCACCTCCAGGTGGTGGGGTCTTGGGCC
CAAGGAGCAGAGAAGACACCATGTGGCCCCTGATTGGTCGAGTATGGCCTGGCTTTGAGT
TTGGGAGGTGTGCAGGGCATGGATGGGGACCCACCAGAGAAAGCACGGGCCCATGGAGCC
CCAGGCTGCGATTTCTGATGCGTACTTGGAGAGGGCGCCTGGTTGGGCACCCACCATGCC
CAAGGGTAGGCTATGCAACTACCAGGTCTGCGGCAGTGCATGGCATCAGGACCAGCCTCC
TTTGTTGGCTGTGAGCTGGTTGGTGGCCCTAGCCCGTGTCCAGTGATCTCTGTGCAGCCC
TGGGGTCATGTGGAGCAGCCAGTGTAGGCAGGGGAGGTTATCTTGAGGTGTGCAGTAGGC
ACATCCCAGGCGTCTTTCCCGAGCCCAGTGACCTCCCTGCCCTGTCCTTCCAGGGTTCGG
TGGCGGGGAGGCCCAAGGGTACCCTGTGTCCATGACAGGTCAGTATTTCATGTGAATCCC
ATCACATGGGCCCTCCTCCTGTCCCCCCAGATGGTGAGCCTGGAGGAAGACTTGCACTGG
GCCTTCTGTGCGCCGGCCAGAGGCCATCAACCAGGTGCCCAGGTCCTGTTGTACTGAAGC
TTGGGCCCTTCCTGGCACCCTGGTCTCCTTCATGGAGCTGGGGAGCCCATCCGGGTTCTT
CTGGATGTATGCATGGGGAGCGGGGTGCACTGGGTTGGGTCAATGATGAGAACCTTATAT
TGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTAAGCTGAGTCCCAG
CCTAGGTGACAATTTTGGAAGTGGACACTGAGAATCACGAGGTCCCTGGCAGGGCCACTG
TATTTTGGGCTGGAGACCTGGAGGCCCTCAAGGGCCTCTCACAGGGACCCAACCCTGTCT
CTGCACTCCTCCGTGAAGCACAGCAGGCTCCCTGTGCGGACTTGGTGTTGGCACTGTTTC
CCAGGGGCAGGGCACATTGGTGGCTTTTCCCTGAGTCCCCATTCTTGCCTTGTGTCTTTC
AGTGAGCTCTTCAGCTCAGAAGGGCCCCTTCACCTTGATTAGCGTAGGTGAGTGCATCCT
GCTGGTGTCATGGGCCATGAGTCAGGCCGCGTGGGGTCACCAAGGGTCAGTCTTTAGGAC
AGGAGGGTTTCCTCAGGGAGCCAACCTGTATTTCCACCGGGGAGGGATGGTTTCTCCAGG
AGGGCGGCTTCCTTGGGAACTGGACCCAAGATGTTGCCTTCCTGAAGCCCTGCAGGGATG
ACAGTGGTCCAGGCAGGAAAGACTTCCTTCAGCCCCGTGCAGGAGAGCTCCCAGCTGAGA
CTCAGTGCATGTGTCAGGCCTCGAGGATTGCCGAGGCCACATGACGGGGGCCACAGGGCC
TCCGGGGCACCACGGGGGTCATGCAAGAGTTCTCTTTCCCTGGAGAGGGGTGCTTGAATG
AGCCTATGGGGTTGGGCCGTGGAGATTCAAGGATTGTACCCAACTATGTCCCAAAATGGG
ACTGACCCTGTTGAGCTATGGACCATCCCATGGTGCCTCTTTGAGCTTGGTGGGGGGCAG
TGCTGTTTCCCTGGGTTTGGGTCAAGGCTGAGCTCTGGCCAGTGCCTGGTGGGGCTGTGG
GCCGGACCTGGGACTCGTGGGCTTTAGGCCAAGTCGACAACTTGTGTTCTGCTGGAGGTC
ACCCCTTCCCCATGGGTGAGTGGCTGGAAGAGTGGAATGTGCGGTGGGAAGGCCCGCTGT
TGATGGTCCTATCCCGAGAATTTGCTGCCCAGACTCTTTCTGTGCCATGGGGTCATGTCC
AGGGTGGCAGGGTCTTGGGCCTAAGGAAAGGAAAGGACACCATGTGGCCCANGATTGGCC
AAGGTTGGCCCGGCTCTGTGTTTGGGACATGTGTGGGGCATGGATGGGGACCCACCAGAG
AAAGCACATGGCCCTGGTACTCCAGGCTGTGATTTCAGGTGTGGCTTGGAGAGAGTGCCT
GGGCAGGTGCCCACCATGCCCAGCGGCAGGCTATGCAACTTCCATGTCCACGGTGGCACA
TGGCTTCTGGGCCAGGCTCCTCGGTTGGCCATGAGCATGTCGGTGACCCTGTCCCATGCT
CAGTGGTCCTGGGGCAGCCCTGGGATCATGTGAAGGAGAAGTCAGAGGGGGCACTGGAGG
TGCCCTCAAGGTCTGCAGTAGCATGAAGACCAGGGGTCTTGCCCAAGCCCAGTGATCCAC
CTGCCCTGTTTTTTCAGGGTTTGGTGATGGGGAGGGCCGAGAGTGCCCTGTATCCGTGAC
AGGTCAGTGTTCCACATGGATCCCATCACATGGGTATCCCTTACCCCGTTCCCCACCTGG
AGGTATGAGGCCCTGTTTGGACACATGTCCTCCTCCTGTCCATCCAGATGGTGAGCCTGA
AGGAAGACTTGCGTCAGGACCAATGGACCCTGGCAAGTGTCCGTCAGCCAGGTGCTCAGC
CCCTGGTGCACTGAAGCTCAGGCCCTTCCTGGCCCCTTGATCTCCTGCACTGAGCTGTGG
TGAGCACATCCGGGTCCCGCTGGATGCATGTGTGGGCAGGGGGGGTGCCCTGGGTTGGGT
CAATGATGAGAACCCTATATTGTGTTGAAGAGAGGTGATGACTTAAAATTACCATGCTCA
ATGATTACGCTGAGGCCCAACCTAGGTGAGAAATTTGGAGGAGGATGCTGGGATCCCGAG
ATTTCCGGCAGGGCCACTGTATTTTGGGCTGGAGCCCTGGAGGCCCTGAAGGGTATCTGG
GGGAGGCCCAACTCTGTCTCTGCACTCCTCTGTGAGGCAGCCCAGGCTCCCTGTGCGGGC
TTGGTGTTGGCCTTTCTGTTCCCCAGTGAAGTGGCACGTGGGTGGCTCCTCCCTGAGCCC
CAGTTCTCCCCTTGTGTCTTTCAGTGAGCTCTTCTGCCAAGGGGGGGCCTCCTGGCATTG
ACCAACATAGGTGAGTGGATCCTGCTGGCATCATGGGCATGGGTTCACCGAGGGTCAGAC
TTCAGGCCATGAGGGTTTCCTCAGGGAGCTGACCCCAATTCCCATCAGGGAGGGATCGTT
TCTCCAGGAGGGCGGCTTCCTTGGGAATCTTACCTGAGGAGGATGCCTTCCCTGAAGATC
TGCAGGAATGACAATGGTCCAGATAGCAAAGGGTTCCTTCAGCCCCATGCAGGACATCGC
CCAGTTGAGACTTGGTGTGCAGGTCAGGCCTTGAGGACTGCCCAGGCCACATGAGGCGGG
CCAGAAGGGCTCCAGGGTGCCACAGGTTTCACTTGGGAGCTCTCGGTCCCCGGGCATGTT
CCTGGGGGGGTGGTGATGGGGTCGGGCCATGGAGGTTCAAAGATCTCATCCCACCTGTGG
CCCTGAATGGGGCTGATCCTGTTGAACAATGGGCCATCCCAGTGGCACGTATTGAGCCTG
GTCAGGGGTGGTGCAGTTTCAATGGGTTGGGTCAAGGTTGAGATCTGGCCAGCTCCTGGT
GGTGCTTCAGGCCAGTCCTGTGACCCATGGGCTTTGGGCTAAGGGGGCATCCCATGTCCC
ATGGGGGTCACCTGTTCTCAATGTTTGAGTGGCAGTAACAGTGGCATTCTGAGGTGGGAA
GGTCCACTGTCTAGGGTGTTGTACCGGGAATTTGCCACCCCGGCTTCTTAGCCAAGGGGT
CACCTCCAGGGTCTCGGGATCTTGGGCCCAAGGAAACGAGAAGATACCATGTGGCCCTTG
ATTGGCCGAGTGTGGCCCAGATCTGTGTTTGGGAGGTGTGGGATATGAATGGGGTCCCAC
CAGTGAAAGCTCATGGCCCGGGTCCCCAGGCTGTAATTTTCAGTGCACACTTGGGGAGGG
CTCCTCAGTGGGTGCCCACCACGCCCAGAGGCAGGCTATGTGACTGCCAGGTTTGCAACG
GTGCATAGCTTCCAGGCTACCCTCCTTGGTTGGCTGGGAGCGGGTTGGTGGCCATGGCCT
ATGCCCAGTGGTCACAGGGCAACCCTGGGATCATGCGGGGGAGCTGGTGAGGGCAGTGGA
GGTGCTCTCCGGAACGGAAGTATGGCGCAGCCCAGGTATCTGGCCCAAACCCAATGACCA
GCCTGCCTTGTTTCTCAGGGTTTGGTGATGGGGAGGGCCAAGGGTGCCCTGCATCTGTGA
TGGGTCAGTGTTCCACATAGAACCCATTACAGGGGATTCCTTATCCCCTTCTCCACATGG
AGATGTGAGGCCCTGTTTGGACACATATCCTCCTCCTGTCCCCCCAGATGGTGAGCCTGG
AGGAAGATTTGCATTGGGCCCAATGGCCCTGGGCCAGTGTCTGTCAGCCAGTTTCCCAGC
CCCTGGTGCACTGAAGCTCAGGCCTTTCCTGGCATCCTGGTCTCCTGCACTGGGCTGTGG
TGAGTATATCATGGTCCTGCTGGATGCATGTGCAGGGAGGGGGGTGCCTTGGGTTCAGTC
AGTGTCGAGGACCTTATATTGTTCTGAAGAGAGGTGGTGACTTAAAAATCATGCCCAATA
GGACTACGCTGAGGCCCAGCCTAGTTGAGAATTTTGGAAGAGGACAGTAGGATCCCGAAG
TCCCTGGCAGGGCCCTTGTATTTTAGGCTGGAGACTTCAAGGCTCTGAAGGGCACCTGGA
GGTGGCTCAACCTGTCTCTGTGCTCCTCCATGAGGCAGTCCAGGCTCCCTCTGTGGGCTT
TCTGTTGGCACTCTGGTTCCCTGGGCCAGGGAACGTTGGTGGCTCCTCCCTGAGCCCCTG
TTCTCCCCTTGTGTCTTTCAGTGAGTGCTTCTGCCCTGGCAGGCCACTTGGCATTGACCG
GTATAGGTGAGTGGATCCTGCTGGGGTCATGGGTCATGAGCAAGGCCACATGGGTCGCCG
AGGGTCAGCCTTACAGCCATAAGGGTTTTCTCAGGGAGCCCACCTGAATTCCCACCGGGG
AGGCATAGGTTCTCCAGGAGGGCGGCGTTTTGGGGAATCAGACCCAAGGGGGACACCTTC
CCTGAAGCCCTGCAAGGGCGATGGTGGTCCAGGCAGGAAAGGGTTTTTTTCAGCCCCACA
CAAGGCAGCTCCTAGCTGAGAATCGGTGCTTGGGTCAGACCTCAAGGATTGCCCAGGCCA
CATGAGGGCGACTGAGAGCCTCCGGGGCGCCACAGGGGTCACATGGGAGCTCTCGGTGCC
TGGCGTGTGATGCACAAATGGACCTCTTGGGTTTGTTCACGGAGATTCAAGGATCGCACC
CCACCATGCCCCTGAATGGGACGGTCCCTCTTGAGAAATGGGCCATCCCAGTGGGTCTCC
TGGAGCCTGGTTGGGGGGTGGCATTGTTTCCCTGGGGTTGGGTGAAGGCAGAGTTCTGGC
CGGCACCTGGTGGTGCTGCAGGTCAGCACTGGGACCCGTGGGCATTGGGCCAAAGGAGAG
CCCGAATCCCACTGGGGGTCACCCTTTTTCCAACATCAAATATCTGGAAGGGTGGCCTCC
TGAGGTGGGAAGGCCTGCTGTTGAGGGACATGTCCCGGGAATTTGTCACTCAAGCTTCTT
CTGAGCTTTGGGGTCACATCCAGGGTGGCAGGGTCTTGGGTCCAAGCAAAGCAGAGGGCA
CCATGTGTCTCCTGATTGGCCAAGTGTTGCTGGCTCTGTGTGGGAGGTGTGCAGAGTATG
GATGGGGACCCACGAGAGAAAGCACGTAGCACTGCAGCTCCAGGCTATGATTTCTATTGC
ATGCTTGGAGAGGGTGCCTGGACAAGCGTGCCATGCCCAGGGGCAGGCTGGGCAACTACC
AGGTCTTCAGCAGAGTGTGACATCTGGGCCAGCTTCCTTGGTTGGCCGTGACCTGGTTGG
TGGCCCGGCTCTGTGCCTACTGGCCCCAGGGCAGCCCTGGGATCATGCAGGGGAGCCATT
TTGAACAGTGGAGGTGCTCTTGGGGCCTGTAGTATGGCACAGCCTAGGTGTTTTGCTCAA
GCCCAGTGACCCACCTGCCCTGTCCTCTCCGGGATCGGTGGAAGGGAGGGCCAAAGGTGC
TCCGTGTACTTGATGAGTCAGTATTTCACATTGAACTCATCACATGTGTCCATGGAGGGT
GAGCAACGGTGAGATGGCACTGCTGACCCCCTTCCCCACATAGAGGTCAGTTTGGACACG
TGTCTTCCTCCTGTCTCCCCATATGGCGACCCCAGAGGAAAACTTGTGTTGGGCCTGCTG
TCACTGGGCCAATGTCAGTCAGCCAGGTGCCCAGCCCCTGGTGCGCTGAAGCTTGGGCCC
TTCTGGCACCCTTGGCTCCTGCACTGAGCTGTGGTGAGCCCATCTGGGTCCTGCTGGATG
CATGTGCAGGGAGGGGGATACCCTGGGTTAGGTCGATTATGAGAACCTTATATTGTCCTG
AAGAGAGGTGATGACTTAAAAATCATGCTCAATGGGATTACGCTGAGGCCCAGCCTAGGT
GAGAGTTTGGAAGAGGATGCTGGGATTCTGAGGTCCCTGACAGAGTAAATGTATTTTGGG
CTGGAGACCTTGAGGCCCTGAAGGGCATCTGGTGGGCCCACCCCTATCTCTGCGCTCCTC
CGTGAGGCAGCCCAGGCTCCCTGTGCTGGCTTGGTATCTGGGCTCCGGATCCCTGGTTAT
GGGGCACGTTGGAGTCTCCTTCCTGAGTCCCCGTTCTCCCCCGTGTCTTTCAGTGAGCTC
TTCTGCCCAAGTGGTCCCCGCAGCCTTGAGCGGCATAGGTGAGTGCATCCTGTTTCGGTC
ATGGGCCATGAGTGATGCAGCATGGGGTCCTCGACATTCAGCCTTCGGGCCACTAGGGTT
TTCTCAGGCTGCCAACCTACTCCCCACCAGGGAGCGATGGTTTCTCCGGGAGGGCCACTT
CCTTGGGAATCTGACCCAAGGAGCACATCTTTCCTGAAGCCCTGCAGGGGTGACAGTGGT
CCAGGCTGGAAAGGGTTCCTTCAGCCCAGTGTAGGGCAGCTCCCAGCTGAAACTCGGTGG
ACAGCTCAGGCCTGGAGTACTGTCCAGGGCACATGGGGAGGAGGGGCACAGGGAATGTGG
CGCACCCTAGAGGTTACACTGGAGTTCTCTCTCCCTGGAGAGGGGTGAGTGATTGGGCCC
ACACAGTCAGGCTGTGAAGATTCAAGGAATGCTCCACACCCATGGCCTTGAATGGTACCA
ACCCTGTTGAGCAGTGGGCCATCTTATGGTACCTCCTTGAGGCTGGTGAGGGATGGCACT
GTTTCAGTGAGGTTGGGTCAAGACTGAGCTCTGGCTGGCACCTGGTGGTGCTGCAGGCCC
TGGGACTTGGGGGCCTTCAGTCAAAGGGGCAGCTCCGATCCTGCTGGGGACAACCCTTCC
TTGAGGTCCAGTGGTGAAGAGTGTCCTCCTAAGGTGGGAAGGCCTGCTGTCAAGGGAATT
TGCCACCCAGGCTGCTTCTGAGCCTTGGGGTCACCTCAGGGTGGCAGGGTCTTGGGCCCA
AGGAAAGGAGAAGACACCATCTGGTTCCTGATTGGCTGAGTGTAGCCGGGCTCTGTGTGT
TGGAGTTGGGCAGGGCATGGATGGGGACCCACCAGAGAAAGTGTGGCCCAGGGGCCCCCC
AGGCTTGGAGAGGGCACCAGGGCCGGTGCCCACAATGCTCAGGTGCTGGCTCTGGGAGGG
CCAGGTCTGCAGCGGCTTTTGGCATCTGGCCAACCACCTTGGTTGGCCAGGAGCTGGTTG
ATGGCCCTCTCCTGTGCCCTGTGTCCCTCGTATGGCCCTGGGGTCATGTGTGGGAGCTGG
CCTGAGCAGTGGAGGTGCTCTTGGGGCCTGCAGTAGGGTACAGCCTAGGCATCTTGCCTG
AGCCAGCACTGTCTTTTGCTTTCCCTGTCTTTCCAGGGTTTGGTGGCAGAGAGGGCAAAG
GATGCCCCACATCTGTGTTGGGTCAGTGTTCAGCATGGATCCCATCACATGGGTATCCCT
TAGCCCCTTCCCTGCATTGATATGTGAGGCCCTGGTTGGACACATGTCCTCCTTCTGTCC
CTCTAGATGGTGAGCCTGGAGGAAGATGTGTGGGACCCGCAGGCCGAGGGCCAGTGTCTC
TCAGCCAGGTGCTCAGCTCCCAGTGGGCTGAAACTCTGACCCTTCCTGGCACCCTGCTCT
CCTGCACTGTGCTGTGGTGAGCACATCCGGGTTCCACTGGATGTTTGTGCAGGGAGGGGG
TTCCCTGGCTTGGGTCAATGATGAGAACAGGGCCACATGAGGAGGGCCAGAGGGGCTACA
GAGTGCCATGGGGTAACAAGGGAGCTCTTGGTCCCTGGAGTGTGGTGTGTGAATGGGCCC
ATGGGGTTGGGTAGCAGAGATTCAAGGATCCTGCTCTACCCATGGCCCTGAATGTGACCA
TCGCTGTTGAGCAATAGGCCATCCCAGTGGGTCTCCTGGGGCCTGGTTGGGGGGTGGAGT
TGTTTCCCTGGGATTGGGTCAAGGTTGACTCTGGCTGGCACCTGGTGGTGTTGCAGGTCA
GCCCTGGGACTCATGGGCTTTGGGCCAGGGACAGCCCGTATCCCGCTGGGGGTCACCCGA
GTGTTGTGAAGGGTGGCCTCCTGAGTTGGGAAGGCCCGCTATTGAGGCATCTGTACTGGG
AATTTGTTGCTCACGCTGCATGGGAGCCATGGTGTCACCTCCAGGGTGGCAGAATCTTGG
GACCAAGCAAAGGAGAGGGCAGCATGAGACTCCGGATTGGCTATGTGTGACTGGCTATGT
GTCTTGGAGGTATGTGGAGTATGGATGGGGACCCACCAGAGAAAACAAGTGACCCTGAGG
CCCCATGCTGTCTTTTCTGGTGCCTGCATGGAGAGGGTGCCTGTACGCATGCCCACCATG
CCCAGGGGCAGGCTGTGCCACTGTCAGGTCTGCAGTAGCATGTGGCATCTGGGCCAGCCT
CCTTGGTTGGCTGTGACCTGGCTGGTGGCCCGGACCTGTGCCCAGTGGTCCCAGGGCAGC
CCTAGGGTCATGCGGAGGAGCAGTTTTGGCCAGTGGAGGTGCTCTTGGGTCCTGCAGTCC
CGCATACCCTGGGCGTTTTGCCTGAGCCCAGTGACCTACCTGCCTTGTCCTTCCCGGGTT
CGGTGGCAGGGAGAGACACTTGCATAGGTGATGAGTCAGTATTTCGCATGGATCTCATCA
CATGTGTCCATGGAGGGGGAGCAAGCGTGAGCTGGCACCCAACACCCCCTTCTCCACATG
GAGGGTGGTCACATGTTCTCCACCTGTTCCCCTAGATGGTGAGACTTCTGTTGGGCTTGC
TTTTCCTGGGCCAGTGTCCATCAGCCAGGTGCTCAGCCATCGGTGCGCTGAAGCTCCAGC
CCTTCCTGGTGCCCTGATCTCCTGCACTGAGCTGTGATGAGCACATCCGGGTTCCACTGG
ATGCACGTGCGGGAAGGGGGGTGCCCTGGGTTGGGTCAGTGATGAGAACCTTATATTGTC
CTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTA
GGGGAGAATTTTGGAAAAGGATGCTGGGATCCCAAGGTCCCCAACAGGGCCACTGTATTT
TGGACCTGAGACCTGGTGGCTCTGAAGGGCATCTGGAGGTGGCCGAACCTGTCTCTGCAC
TCTAGGTTCCCTGTGTGGGCTTGGTGTCGGTGCTCCAGTTCCCTGGGGGCAGGGAATGTT
GATGGCTCCTTCCTGAGTCCCTGTTCTTGCCTTTGTCTTTCAGTGAGCTCTTTCACCTAG
GAGGGCCTCTTGGCATTGACTGGCATAGGTGAGTGGATCCTGCTGGTGTTATGGATCATG
AGCCAGACCATGTGGGGTCCCCAAGTATCAGCCTTTGGGCCACAAGGGTTTTCTCAGGGA
GCTGACCTGAATTTCCACCTGAGACGGAAAGGTTCTCCTGGAAGGCAGGCTTTTTGGAAT
CGGACCCAAGGAGGACACCTTCTCTGAAGCCCTGAAGGGGTGATGGTGGTCCAGGCAGGA
AAGGGTTCCTTCTGCCTAACATAGGACAGTGCCTAGTTGAGACTCGGTGCTGCAGTAAGG
CCTTGAGGACTGCCCAGGCTACATGAGGGGGGCCAGAGGGGCCACGGGGCACCACAGGGT
TAATGGTGACCTCTTGGTCCCCAGAGTGTGGTGCGTGAATGGACCCATGGTGTTGGGTTG
TGGAGATTCAAGGATAGTGCCCCACCTATGGCCCTGAATGCAACTGTCCCTGTTTAGCAA
TGGGCCATCTCAGTGGGTCTCCTGGAGCCTGGTGGGGGGCAGAGTTGTTTCCCTGTGACT
GGGTTAAGGTAGAGCTCTGGCCGGCACCTGGTGGTGCTGCAGGTCAGCCCTGGGACTCTT
GGGCTTTTGACCAAGGGGCAGCCTGTATCCCGCTGGGGGTCATCCTATCTCTGAGGTCAA
GTGTCGTGAAGGGTGGCCTCCTGAAGTGGGAAGGCTCGCTGTCGAGGGACCTGTCCTAGG
ATTTTATTGCTCAGGCTGCTTCTGAGCCATGGTGTCACCTCTAGGGTGATGGGGTCTTGG
GAACAAGCAAAGGGGAGGGCACCATATTGCTCCGGATTGGGCAAGTGTGGCCCAGCTCTC
TGTGTGTGAGGTGTGCAGAACATGGATGGTGACCCACCAGAGAAAGCACATGGCCCTGTA
GCTCTAGGTTGTGATTTCCGTGCACACTTGGAGACAGCATCTTGATGTGTGCCCAGCAAG
CCCAGGGGCAGACTATGCGATAGCCAGGTCTGCAGCGGTGTGTGGCATCTGGGCCAGCCA
CCTTTGTTGGCCATGAGCTGGCTCATGGCCCTGACCCATGCCCACTGGTGTCAGGGGGCC
CTGGGGTCGTGTGAGGAGCCATCTGTGGCAGTGGAGGTAGACTCAGGGCCTGCAGTATGG
CGCAACCCATGCATTTTGCCTGAGCTCAGTGACCTACCTGCCCTGTTCCTCCAGGGTTTG
GTGGCAGGGGGAGCCAAGGGTGCCCCACATTGGTGACGAGTTAGTACTTCACATGGATCT
CATAACATGTGTCCGTGGAGGGCAAGCAAATGTGAGCCCCCACCCACTACTGCCTTCCCC
ACATGGAGGTCAGTTTGGACACATATCATCCTGCTGTCCCCCAAATGGTGAGACCGAAGA
AGACTTGCCCTGGGCCCTCTGTTCTTGGGCCAGTGTCAGTCAGCCAGGTGCCCAGCTCTA
AGTGCACTGAAGCTTGGGCCTTTCCTGGAATGCTCGGCTCCCGCACTGAGCCAGGGTGAG
CACATCCGGGTCCTGCTGGATGCATGTGTGGGGCAGGGGTGTGCCGTGCGTTGGGCTGAT
GATGAGAACCTTATATTGTCCTGAAAAGAGGTGATGACTTAAAAATCATGCTCAATAGGA
TTACATTGAAGCCCAGGATAGGTAAGAATTAGGGAAGATGATGCAGGGATCCCAAGATCT
CCAGCTAGGCCACACTTATTTTGCACTGGAGAACTTGAGAACTTGAAGGGCATCTCAGGG
GAGCCCAACCCTGTCTCTGAGCTCCTTCGTGAGGCAGCCCAGGCTCCCCTTGCGGGCTTG
GTGTCTGTGCTCCGCTTCTCCAGGGACAGGGCAATTTGGTGCTGCTTCCTGAATGCTCCT
TCTTCCCTGTGTCCTTCAGTGAGCTCTTCTGCCCAGGTGGGGTCCCTGGCTTTGAGCGGC
ATAGGTCAGTGCATCCTGTTGGGCTCATGGGCCATGAGTGAGGCAGCATGGGGTTGTTGA
GAATCAGCCTTCAGGCCACTAGGGTTTTCTCAGGGAGCCAACCGATTACTCACCGGGAGG
GATGGTTCCTCCAGAAGGGTCACTTCTTGGGAATCTGACCCTAGGAGCACACATTTCCTG
AAGCTCGGCAGGGAGATGGTGGTCCAGGCAGGAAAGGATTCCTTCAACCTAACGTAGGGC
AGTTCCCAGCTGAAACTAGGTGGTCAGGTCAGGCTTGAGGACTGCCCAGTCCACATGAAA
GGGGCCACAGGGGCTTTGGGGTGCCCTGGGAGTCATGCTGGAGTTCTTCCCCCAAGAGGG
GTGGGTGATAGGGTCCACGCGGTCAGGCTGCGGAGATTCAAGGAATGCCACCCACCCATG
GCCCTGAATGGGACCAACCCTGTTGAGCAATGGGCCATTTTCGGCACTGTTTCAATGCAG
TTGGGTCAAGGCTGAGCGCTGGCTGGTGCCTGGTGGTGCTGCAGGCCGGCCCTGGGGCTC
ATGGGCTTTATGCCAAGGGGGCAACTCCCATCCCACTGGGGTAATCTCTTCCTTGAAGTC
CAGTGGTGGGAAGGGTGGCCCCCTGAGGTGGGCAGACCTGCTGTCAAGGGACCTGTCCGG
GGAATTTGCCACCTAGGCTGCTTCTGAGCCATGGGGTCACCTCCAGGATGGCGGGGTCTT
CAGCCCAAGGAAAGGAGAGGACACCACGTGGTTTCCGATTGGCTGAGTGTGGCCTGGCTG
TGTGTGTGGGAGGTGTGCAGGGCATGGATGGGGACTCATCAGAGAAAGAATGTGGCCCTG
GAGGCCCCCAGGCTTTGATTTCTGGTGTGTGCTTGGAGTGGGCACCAGGGTGGCCCTACC
ATGCCCAGGGGCAAGGTCTTTGACTGCCAGGTCTGGAGTGGCTCCTGGCATCAGGACCAC
CCTCCTTGGCTCAACCAACCTTCAGCAGGTTGGCTGCCTTGGCCCGTGCCCCATGGTCCC
GGTGCGACCCTGGGGTTGTTTGGGGGATCTGGCCCAGGCAGTGGAGGTGCTCTTGGGGCC
CGCAGTAGGGCACAGCCCAGGCCTCTTGCCCCAGCCCAGTAACCCACTTGCCCTGTCTTT
CCAGGGTTTGGTGGCAGGGAAGGCCAAGGGTGCTCTGCGTCCATGTTGGGTCAGAGTTCT
GTAAGGATCCCATTACAAGGGTATCCCCTACCCACCTTCCCTACATTGATACATGAGGCC
CTGGTTGGACACATGTCCTCCTCCTGTCCCTACAGATGGTGACCCTGAAGAAAGACTTGA
GTTGGGCCTGAAGGCCCCGGGCCAGCGTCCATCATCCAGGTGCTCAGCTCCCAGTGCACT
GAAGCTCAGACCCTTCCTGGTTCCCTGGTCTCTTGCCCTGAGCTCTGGTGAGCACAACTG
GGTGCTGCTGGATGCATGCATGGGGAGGGGGGTGCCCTGGGTTGGGGTGGTGATGAGAAC
CTTGTATTCTTCTGAAGAGAGGTGATGACTTAAAAACCATGCTCAATAGGATTACACTTA
GGCCGAACCTAGGTGAGAATGTTGGAAGAGGACGTTGGGATCCTATTATCCCTGGCAGAG
CCACTGTGTTTTGGGCTGGAGACCTGGAGGCCCTGAAAGGGCATCTGGAGGGGGCCCAAC
CCTGTCTCTGTGCTCCTGCATGAGGGTCCCCAGGCTCCCTGTCCAGCCTTGGTGTTGGTG
CTCTGGTACCCTGGGGATGGAACAAGTTGGTGGCTCTTTCCTGAGCCCCCATTCTCCCTT
TGTGTCTTTCAGTGAGCTTTTCTGCCCAGGTGGGCACTCTGGCATTGATTAGCCTCCTTG
GTTGTCCATGACCTGGCTGGTGGCCCGAGCCTGTGCCCAGTGGTCCCAGGGCAGCCCTGG
CATCATACGGGACAGCTGTTTTGGGCAGTGGAGGTGCTCTCCAGGCCTGAAGTATGGCAC
AGCCTGGGCATTTTACCTGAGACTAGTGACCTGCCTGCCTTGTCCTTCCTGGGTTCGGTG
GCAGGGAGGGCCAAGGGTGCCCTGCGTCAGTGCTGAGTCAGTATTTTGCGTGGATCTCAT
CACGTGTCCATGGAGGGAAAGCAAGCATGAGCTGGCACCCAACACCCCCTTCTCCGCATG
GAGGGTGGTCACATGTCCTCCACCTATGCCCCCAGATGGTGAGACTTGAGGAAGACTTCC
ATTGGGCCTGCTTTTCCTGAGCCAGTGTCCATCACCCAGGTGCTCAGTCCCTGGTGCACT
GAAGCTCCAGCCCTTCCTGGCGCCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCCG
GGTTTCACTGGATGTTTGTGCGGGGAGGGGGTTCTCTGGGTTGGGTCAATGATGAGAACC
TTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAG
GCCCAGCCTAGGGGAGAATTTTGGCAGAGGATGCCGGGATCCCAAGATTTCTGGGAGGGC
CACTTGTATTTTGGGTTGGAGACCTGGAGGCCCTGAAGGGCGTCTGGAGGTGGCCCAATG
CTTTCTTTGCGCTCCTCTGTGAGGCAGCCCAGGCTCCCTTTGTGGGCTTGGTGTTTGCGC
TCCTCTTCTCCAGTGATGGGGCACGTTGGGGGCTCCTCCCTGAGTCCTGGTTCTCCCCTT
GTGTCTTTCAGTGAGCTCTTCTGCCAAGCGGTTCCCCTGGCATTGACCAACATAGGTGAG
TGGATCCTGCTGGCATTATGGGCCATGAGCTAGGCCGCATGGGTTTGCTGAGGGTCAGAC
TTCAGGCCCCAAGGGTTTCCTCAGGGAACCGACCTCAATTCCCACCATGTGACTGCCAGG
TTTGCAACAGTGCATAGCTTCCGAGCTACCCTCCTTGGTTGGCCAGGAGCTGGTTGGAGG
CCGTGGCCCATGCCTAGTAGTCACAGGGCAGGCAGACTGCCCTGTTTTTTTCAGGGTGTG
GTGATGGGGAAGGCCAAGGGTGCCCTGCATCCATGATGGGTCAGGGATTTCAGGAGGGAT
GGTTTCTCCAGGCGGGCAGCTTCCTTGGGAATCTTACCCAAGGAGGATGTCTTCCCTGAA
GCCCTGCAGGGGTGACGATGGTCCAGATAGCAAAGGTTTCCTTCAGCCCCATGCTGGACA
TCACCTAGTTGAGATATGGTATGTGGGTCAGGCTTTGAAGACTGCCCAGGCCACCTGAGG
GGGGCCAGAAGGGCTCTGGGGTGCCACAGGTGTTATGTAGGAGCTCTCAGTCCCCAGACT
TGTTTCGTGGGGTTGGCGACGGGGTTGGGTTGTGGAGGTTCAAGGATTTCATCCCACCTG
TGACCCTGAATGGGGCTAACCCTGTTGAGCAACAGGCCATCCCAATGGCACGTATTGAGC
CTGGTGGGTTGTGGTGCAGTTTCAATAGGGTTGAGTCAAGGCTGAGATCCATCTGGTGCT
TGGTGCTGCTGCTGGCCAGCCCTGGGACCCGTGGGCTTTGGGCTAAGGGGGTAGCCCAGA
TCCCATTGAGGGTAACCCATTCTCCGAGTTTGAGTAACGGTTAACAGTGGCATTCTGAGG
TGGGAAGGCCCACTGTCTAGGGTCCTATACTGGGAATTTGCCACCCCGGGTTCTTCTGAG
ACATGTGGTCACCTCCAGGGTCATGGGGTCTTGGGCCCAAGGAAAGGAGAAGATACCATG
TGGCCCTTGATTGGCTACATGTGGCCCAGGTCTGTTTGGGAGGTGTGTGGGATGTGGATG
GGGTCCCGCCAATGAAAGCACATGGCCTGGGTCCCCAGGCTGTGATTTTCAGTGCACACT
TGGAGAGGGTGCCTCGGCGGGTACCTACCACATCCATGGGCAGGCTATGTGACTGCCAGG
TTTGCAACAGTGCATAGCTTCCAAGCTACCCTCCTTGGTTGGTCGGGAGCTGGTTGGAGG
CTGTGGCCCATGCCTAGTGGTCACAGGGCAGGCAGACGGCCCTGTTTTTTCAGGGTATGG
TGATGGGGAGGGCCAAGCATCCATGATGAGTCGGTGTTCCACATGGAACCCATTACGTGG
GTATCTCTTACCCCTTCCTCATATGGAGATGTGAGGCCCTATTTGGACACATATCCTCCT
CCTGTACCCCCAGATGGTGAGCCTGGAGGAAGACTTGCGTTGGGCCCAAAGGCCCTAGAC
CAGTGTCTGTCAGCCAGGTTCCCAACCCCCGATGCGCTGAAGCTCAAGCCTTTCCTGGCA
CCCTGGTCTCCTGCACTGAGCTGTGGTAAGTATATCCTGGTCCTGCTGGATGCATGTGCA
CGGAGGTGGGTGCCTTGGGTTGGGTCAATGATGAGAACATTATATTGTTCTGAAGAGAGG
TGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGTTGAGAATTT
TGGAGGAGGACACTGGGATACCGAAGTCCCCCGCATGGACTCTGTATTTTGGGCTGGAGA
CCTTGAAGCCCTGAAGGGCATCTGGAGGTGGCCCATCCTGTCTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNATAGGTTCTCCAGGAGGGCGGCTATTTTGGGAATC
AGATCCAAGGGGGACACCTTCCCTGAAGCCCTGTGGGTGTGATGGTGGTCCAGGCAGGAA
AGGGTCCCTTCCACCCCACACAGGGCAGCTCATAGCTGAGAGTTGATGCTTAGGTCAGGC
CTCAAGGATTTCCCAGGCCACATGAGGGAGACAGAGGAGCTCTGGGTGCCACGGGGCTCA
CATAGGAGCTCTCAGTATTCGGTGTGTCATGCACAAATGGGCCTCGGGTTGGATTGTGGA
GATTAAAGGATCGCGCACCACCGTGGCCCTGAATAGGACCGTCCTTATTGAGCAATGGGC
CATCCCAGTGAGTCTCCTGGAGCCTGGTGGAGGGGAGGGGGTGGCATTGTTTCCCTGGGG
TTGGGTCCAGGCAGAGCTCTGGCCAGCACCTTGTGGCTTCTGCAGGTCAGCCTTGGGACT
CATGGGCATTGGGCCAAGGGGGAGCCCGCGTCCCACTGGGGGTCACCCTTTTTCCGACGT
CAAGTATCTGGAAGAGTGGCCTCCTGATGTGGGAAGGCCTGCTGTCAAGGGACGTGTCCC
AGGAGTTTGTCGCTCAAGTTTCTTCTGAGCTTTGGGGTCACATCCAGGGTGGTGGGGTCT
TGGGCCCAAGCAAAGCAGAGGGCACCAAGTGTCTCCTGATTAGCCATGTGGCTGTCTCTG
TGTGTGGGAGGTTTACAGAGTATGGATGGGGACCCACCAGAGGAAGCACGTGGCCCTGCA
GCACCAGGCTGTGATTTCTGTTGCACACTTGGAGAGGTTGCCTGGACACGTGCCCTTCAT
GCCCAGTGACAGACTATGCAACTACCAGGTCTGCAGCAGGGTGTGACATCTGGGCTAGCC
TCCTTGGTTGGCCGCCACCTGGCTGGTGGCCCGGATCTGTGCCCAACAGTCCCAGTGCAG
CACTGGTGTCATGCAGGGGAGCTGTTTTGGACAGTGGAGGTGCTCTTGGGGCCTGCAATA
TGATGCAGCCTGGGCGTTTTGCTCAAGCCCAGTGACCCACCTGCCCTGTCCTTTCTGGGT
TCAGTGGAAGGGAGGGCCAACAGTGTAGTGCGTACTTAACAAGTCAGTATTTCACATTGA
ACTCATCACATGTGTCCATGGAGGGCAAGCAAAGGTGAGCTGGCACCCCCGACCCCCTTC
CCCAAATGGAGGTCAGTTTGGACACACGTCTTCCTCCTGTCTCCCCAGATGGTGACCCCG
GAGGAAAATTTGTGTTGGGCCCACTATGCCTGGACCAATGTCAGTCAGCTAGGCACCCAG
CCCCCAGTGCGCTGAAGCTCAGGACCTTCCTAGTGCCCTCGGCTCCTGCACTGAGCTCTG
GTGAGTCCATCTGGGTCCTGCTGGATGCATGAGCTGGGGGCGGGAGGGTGCCCTGGGTTG
GGTCAGTGATGAGAACCTTATATTGTCCTGAAGAAAGGTGATGACTTAAAAATCATGCTC
AATAGGATTACACTGAGGCCCAGCCTAGGTGATAATTTTGGAAGAGGATGCTGGAATTCT
GAGGTCCCTGACAGAGCAGCTGTATTTTGGGCTGGAGACCTTGAGGCCCTGAAGGGCATC
TGGTGGGCCCAACCCTGTCTCTGTGCTCCTCTGTGAGGCAGCCCAGGCTCCCTGTGCTGG
CTTGGTATCCGGGCTCTGGGTCCCTGGTGACGGGGCATGTTGGAGGCTCCTTCCTGAGCC
CCTGTTCTCCCTTGTCATTCAGTGAACTCTTCTGCACAAGTGACCCCCCCAGCCTTGAGC
GGCATAGGTGAGTGCATCCTGTTTTGGTCATGGGCCATGAGTGATGCAGCATGGGGTCCC
CGACATTCTGCCTTTGGGCCACCAGGGTTTTCTCAGGCTGCCAACCTACTCCCCACCAGG
GAGCGATGGTTTCTCAGGAGGGCTGCTTCCTTGGGAATCTGACCCAAGGAGCAAGTCTTT
CCTGAAGCCCTGCAGGGGTGACAGTGGTCCAGGCTGGAAAGGGTTCCTTCAGCCCAATGT
AGGGCAGCTCCCAGCTGAAACTCAGTGGGCAGGTCAGGCCTCGAGTATTGCCCAAGGCAC
ATGGGGGAGTGAGGCACAGGGGATGCAGTGCGCCGTGGAGGTGACACTGGAGTTCTCCCT
CCCTGGAGAGGGATGAGTGACTGGGTCCACACGGTCAGCTGCGGAGATTCAAGGCATGCT
CCACACCCATGGCCTTGAATGGGACCAACCCTGTTGAGCAATAGGCCATCTTAGTGGCAC
CTCCTTGAGCCTGGTGGGGGACGGCACTGTTTCAATGAGGTTGGGTCAAGGGTGAGCTCT
GGCTGGCACCTGGTGGTGCTGCAGGCCCTGGGACTTGTGGACTTCGGGCCAAGGGAGCAG
CTCTGATCCTGCTGGGACAAGCCTTCCTTGAGGTCCAGTGGTGAAAAGGGTGTCCTCCTG
AGATGGCAAGGCCTGCTGTCGAGGGACCTGTTCTAGGAATTTGCTGCCCAGGCTGCTTCT
GAGCCTTGGAGTCACCTCAGGGTGGCAGGGTCTTGAGCCCAAGAAAGGAAAAGACATGGT
GTGGTTCCTGATTGGCTGAGTGTGACCCGGCTCTGTGTGTCAGAGTTGGGCAGGACATGG
ATTGAGACCCACCATAGAAAGCATGTGATCCTGGAAGCCCCTAGGCTTGGAGAGGGCACC
AGGGCCAGCGCCCACCACGCCTAGGTACGATCTCTCGGACTTCCAGGTCTGCAGCGGCTC
TTGGCGTCTGGGCCAGCATGCTTGGTTGGCCAGGGGCTGGTTGGTGGCCCTGTCTTGTGC
CCTGTGTCCCCGGTATGGCCCTGGGGTTGTGTGTGGGAGCAGGCCCGGGCAGTGGAGGTG
CTCTTGGGGCCTGCAGTAGGGTGCTGCCCAGGCATCTTGCCCGAGCCAGGTGACACGCTT
GCCCTGTCTTTCCAGGGTTTGGTGGCAGGGAGGGCCAAGGGTGCCCAGTGTCCGTGAGGG
ATCAGTATTCAGCATGGATCCCATCACATGAGTATCCCTTAGCCCCTTCTCTGCATTGAT
GTGTGAGGCCCTGGTTAGACACATTTCCTCCTCCTGTCCCTCCAGATGGTAAGCCTGGAG
GAAGACTTGTGTTGGGCCCACAGGCCCCAGGCCAATGTCTGTCAGTCAGGTGCTCAGCCT
CTGGTGCGCTGAAACTCTGACCCTTCCTGGCACCCTGGTCTCCTGCACTGAGCTGTGGTA
AGCACATCTGGGTTGCACTGGATGTTTGTGTGGGGAGGGGGTTCCCTAGGTTGGGTCAAT
GATGAGAACCTGATATTGCCCTGAAGAGAGATGATGACTTAAAAATCATGCTCAATAGGA
TTACGCTGAGGCCTAGCCTAGGTGAGAATTTTGGAAGCGGATGCTGGGATCCCAAGGTCC
CTTGCAGGGCCATTGTATGTTGAACTGGAGACCTGGAGGCTCTGAAGGGCATCTGGAGGT
CGCGCAACCTGTCTCTGCACTCCTCTGTGAGGCAGCCCAGGCTCCCTGTGTGGGGTTGGT
GTTGGTGCTATGGTTCCCTGGGGGTGGGGAACATTGGTGGCTCCCTCCAGAGCCCCTGTT
CTCACCTTGTGCCTTTCAGATTTTCCACCTAGGAGGTCCACCTGGCATTGACTGACATAG
GTGAGTGGATCCTGCTGGGGTCATGGGTCATGAGCCAGACCATGGGGGGGTCCCAGAGAT
TCAGTCTTTGGGCAACAGTTTTCTCAGGGAGCAGACCTGAATTTCCACCTGGGAGGGAAG
GGTTCTCCTGGAGGGCGACTTTTTTGGGAATCGGACCCAAGGAGGATGCCTTCCCTGAAG
CCCTGCCGGGGTGATGGTGGTCCAGGCAGGAAAGTTCCTTCTGCTCAATGCAGGGCAGCA
CCCAGCTGAGACTCGGTGCTCCAGTAAGGCCTCCGGAACTGCCCAGGTCACATGAGGGGG
GCCAGAGGGGCTACGAGGTGCCACGGGGTAACAGGGGAGCTCTTGGTCCCCAGAGTGTGG
TGCACGAATGGGCCCATTCCGTTGGGTCTCAGAGATTTAAGGATTGCACCACACCATGGC
CCTGAATGCAACCGTCCCTGTTGATCAATGGGCCATCCCATGGGTCTCCTGGAGCCTGGT
GGGAGGCAGTGTTGTTTTCCTGGGGTTAGGTCAAGGCGGAGCTCTGGCTGGTACCTGGTG
GTGCTGCAGGTCAGCCCTGGGACTTGTGGGCTTTGGGCCAAGGGGCATCCCGCATCCCGC
TGGGGGCCACCCTTTCTCCATGGTCGAGTGTCGTGAAGGGTGGCCTCCTGAGTTGGGAAG
GCTTGCTATTGAGGCACTTGTACTGTGAATTTGTTGCTCAGGCTGCTTGGGAGCCATGGT
GTCACCTCCAGGGTGGCAGGGTCTTGGGACCAAGCAAAGGAGAGGGCACCATGTCACTGC
AGATAGGCCAAGTGTGACTGGCTCTGTGTCTGGGAGATATGTGGAGTATGAATGGGGACC
CACCATTCATAGAGAAAGCAAGTGGCCCTGCAGCCCGAGGCTATGATTTCCGGTGCACAC
TTGGAGAGGGTGCCTTTACACCCAAGTACCAGGCTCAGAGGTAGGCTATGCCACTATCAG
GTCTGCAGTGGCGCGTGGCATCTGGGCCAGCCTCCTTGGTTGGCCATGACCTGGCTGGTG
GCCTTGGCCTGTGCCCAGTGTTCCCAGGGTAGTTCTAGGGTGCTGCGGGGGAGCTGTTTT
GGCTAGTGGAGGTGCTCTTGGGTCCTGCAGTACAGCACAGCCTGGGCGTTTTGCCTGAGC
CCAGTGACCTGCCTGCCTTGCCCTTCCCGGGATCGGTGGTAGGGAAGACCAGGGGTGCCC
GGCATAGGTGATGAGTCAGTATTTCACATGGATATCATCACATGTGTCCATGGAGGGGGA
GCAAACATGAGCTGGCACCCGCCACCCCCTTCTCCACATGAAGGGTGGTCACACGTTCTC
CATCTGTTCCTCCAGATGGTGAGACTTCTGTCGGCCTCGCTTTTCCTGGGCCAGTGTCCA
TCAGCCAGGTGCTCAGCCCTCAGTGCACTGAAGCTCCAGCCCTTCCTGGCGCCCTGGACT
GAGCTGTGGTGAGCACATCCGGGTTCCACTGGATGCGTATGTGGGAAGGGGGGTGCCCTG
GGTTGGGTCAATGATGACAACCGTATATTGTCCTGAAGAGCGGTGATGACTTAAAAATAA
TGCTCAATAGGATTACGCTGAGGCCCACCCTAAGTGAGAAATTTGGTAGGGGATGTTGGG
ATCCCGAGATTTCTGGCAGGGCCACTGTAGTTTGGGTTGGAGGCCTGGAGGCCCTGAAGG
GCATCTGGAGGTGGCTCAACTCTTTCTCTGTGCTCCTCCGTGTAGCAGCCCAGGCTCCCT
GTGCGGGCTTGGTGTTGTTGCTTCTGTTCCTTGGGGGCAGGGCATGTGGGTGGCTCCTCC
CTGAGCCCCAGTTCTCCCCTTGTGTCTTTCAGTGAGCTCTTCTGCCAAGGGGGTCCTCCT
GGCATTGACCAACATAGGTGAGTGGATCCTGCTGCTGTCATGGTCCGTAAGCCAGGCTGC
TTGGGGTTGCCAAGGGTCAGACTTCGGGCCATGAAGGTTTCCTCAGGGAGCTGACCCTAA
TTCCCATGAGGGAGGCATGGTTTCTCCAGGAGGTCAGCTTCCTTGGGAATCTGTGACTTG
ACAGGGTTGAGTCGCAGAGGTTCAAGGATCTCATCCCACCTGTAACCCTGAATGGGGCCC
ACCCTGTTGAGCAACTGGCCATCCCAGTGGCACATATTGAGCCTGGTGGGGGGTGGTGCA
GTTTCAATGGGGTTGGGTCAAGGCTGAGATATGGCTGGTGCCTGGTGGTGCTGCAGTCCA
GCCCTGGGATCCGTGGGCTTTGGGCTGAAGGGGAAGCCTGCATCCTATTGGGGGTAACCT
GTTCTCCAAATTTGAGTGATGGTGGGAAGGCCCACTGTCTGAGGTCCTGTACTGGGAATT
TGCCACCTCAGCTTCTTCTGAGCCATAGGGTCACCTCCAGGGTCATGGGGTCTTGGGACC
AAGGAAAAGAGAAGATACCATGTGGCCCTTGATTGGCCGAGTGTAGCCCAGCTCTGTGTT
TGGGAGGTGTGTGGGATGTGGATAGGGTCCCACTTGTGAAAGCATGTGGCCCGGGTCCCC
AGGCTGTGATTTTCAGTGCACACTTGGAGAGGGCACCTTGGTGGGTGCCCACCATGTCCA
GGGGCAGGCTATGTGACTGCCAGGTTTGCAATGGTGTGTAGCTTCCGTCTACCCTCCTTG
GTTGGCTGGGAGTGGGTTGGTTGCTGTGGCCCATGCCCAGTGGTCACAGGGCAGGCAGAC
TGCCTTGTTTTTTCAGGGTATGCTGACAGGGAGGGCCATGGGTGCCCTGCATTCATGATG
AGTCAGTGTTCCACATGGAACCCATTATGTGGGTATCTCTTATTCCTTCTACATATGGAG
ATGTGAGGCCCTATTTGGACACATGTCCTCCTCCTGTACCCCCAGGTGGTGAGCCTGGAG
GAAAACTTGCATTGGGCCCAATGGCCCTGGACCAGTGTCTGTCAGCCAGGTTCCCAACCC
CCGATGCGCTGAAGCTCAAGCCTTTCCTGGCACCCTGGTCTCCTGCACTGAGCTGTGGTG
AGCATATCCTGGTCCTGCTGGATGCATGCATGGGGAGGGCCTTGATTGGGTCAATGATGA
GAACGTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACG
CTGAGGCCCAGCCTAGGTGATAATTTTGGAAGAGGACACTGGGTCCCGAAGCCCCCTGCA
GGGCCCCTGTGTTTTGGGCTGGAGACCTTGAGGCCCTGAAAGACATCTGGTGGACCCAAC
TCTATCTCTGCCCTCCTCAATGAGGCAGCCCAGCCTCCCTGTACTGGCTTGGTATCCGGG
CTCCGGGTCTCTGGGGACGGGGCACATTGGAGGCTCCTTCCTGAGCCCCCATTCTCTCCT
GTGTCTTTCAGTGAGCTCTTCGGCCTAAGCGGTCCCCCCGGCCTTAAGCGGCATAGGTGA
GTGCATCCTGTTTTGATCATGGGCCATGAGTGTTGCAGCATGGGGTCCCCGACATTCAGC
TTTCAGGCCACTAGGCTTTTCTCAGGCTGCAAACCTACTCTCCACCAGGGAGCGATGGTT
TCTCAGGAGGGTCACTTCCTTCGGAATCTGACCCATGGAGCACGCCTTTCCTGAAGCCCT
GCAGAGGTGACAGTGGTCCAGGCAGGAAGGGGTTCCTTCAGCCCCAATGTAGGGCAGCTC
CCAGCTGAAACTTGGTGGACAGATCAGGCCTGGAGTACTGCCCAGGGCATATGGGGAGGA
GGGACACAGGGAATGTGGCGCACCCTGGAGGTCACACTGGAGTTCTGTCTCCCTGGAGAG
GGGTGAGTGATTGGGCCCACACGGTCAGGCTGTGGAGATTCAAGGAATGCTCCACACCCA
TGGTCTTGAATGGGACCAACCCTATTGAGCAATGGGCCATCTTAGTGGCACCTCCTTGAA
CCTGGTGGGGGATGGCACTCTTTCAATGACGTTGGGTCAAGGCTGAGCTCTGGCTGGCAC
CCAGTGGTGCTGCAGGCTGGCCCTGGGACTTGTGGGCTTTGGGCCAAGGGGGAAGCTTCC
ATCCTGCTGGGAACAACCCTTCCTTGAGGTCCAGTGGCAGGAAGGGGGGCTTCCTGAGGT
GGAAAGCCCTACTGTTGAGGGACCTGTCCTGGGAATTTGCTGTCCAGGCTGCTTCTGAGC
CATGGGGTCACCTCTAGGGTGGTGGGGTCTTGAGCCCAAGGAAAGGAGAGGACACCATGT
GGTTCCTGATTGGCTGAGTGTGGCCCGGCTCTGTGTGTCGGAGTTGTGCAGGGCATGGAT
TGGGACCCACCAGTGAAAGCACATGGCCCTGGAGGTCCCCAGGCTTGGAGAGGGCACCAG
ATCTGGCGCCCACCATGCCCAGGTACAGGCTCTGGGACTGCCAGGTTGCAGCAGCTCTTG
GCATCTGGGCCACCCTCCTTGGTTGGCCAGGAGCTAGTTGGTGGCCCTGTCCCATGCCCC
ATGTCCCTGGTATGGCCATGGGGTCATGCAGGGGAACCGGCCCTGGCATGGAGGTGCTCT
TGCAACATGCAGTAGGGTGCATCCCAGGCATCTTGCCTGAGCCAGGTGACCCGCTTGCCC
TGTCTCTCCAGGGTTTGGTGGCAGGGAGGGCCAAGGATGCCCCGTGTCCATATTGGGTCA
GTGTTCAGCATGGATCCCATTGCATGAGTATCACTTAGCTCCTTCCCAGCATTGATATGT
GAGGCCCTGGTTGGACACTTGTCCTCCTGTCCCTCTAGATGGTGAGCCTGGAGGAAGACT
CGTGTTGGGCCCACAGGCCCCAGGCAAGTGTACGTCAGCCAGGTGCTCAGCCCATGGTGT
GCTGAAGCTCTGACCCTTCCTGACTCCGTGGTCTCCTGCACTGAGCTGTGGTGACCATAT
CCAGGTCCTGCTAGATGCATGCGTGAGGAGGCAGGGTGCCCTGGGTTGGGTCAATGATGA
GAACCTTGTATTATCTTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACA
CTGAGGCCCAGACTAAGTGAGAATTTTGGAAGAGGATGCTGGGATCCTGAGGTCCCCAAC
AGGGCCACCATATTTTGGGCTGGAGACCTGGAGGTCCTGAAGGGCATCTGTAGGGGGCCC
AACCCTGTCTCTGCACTCCTCCCTGAGGCAGCCCATGCTCCCTATTCGGGATCGGTATTG
GTGCTCCACTTCCCTGGGGGCAGGACACGTGGGTGGCTACTCCCTGAGCCCCCGTTCTCC
CCTTGTGTCTTTCAGTGAGCTCTTCCAAACAGGTGGGCTCCCTAGCATTGACCGACAGAG
GTGAGTGGATCCTTCTGGGATTATGGGCCATGAGCCAGGCCATGTGGGGTCCCCAAGGTT
CAGCCTTTGGATCCCGAGAGTTGTCTCAGGCAGCCAACCTGATTTGCCACCTGGGAGAGA
TGGCTTCTCCAGGAGGGTGGCTTTCTTGGGAATTGGACCCAAGGAGGACGCCTTCCCTGA
AGCCCTACTGGGATGATGGTGGTCCAGGCAGGAAAGGGTTCCTTCACCCAGCTGAGACTC
GGTGTTCCAGTAAGGCCTCAAGGACCTCCCTGCCACATGAAGGGGCCCAGAGGGGCTACG
GGGCACCACAGGAGTGACAGGGGAGCTCTTGGTCCCCAGAGTGTGGTACATGAATGGGCC
CATGGGGTTGAGTCGCAGAGATTCAAGGATGCTGCACCACCCATGGCCCTGAATGCGACC
CTCCTCCTGGAGCCTGGTGGGGGGTGGCGTTTTTACCCTGGGGTTCGGTCAAGGTGGAAC
TCTGGTCGGTACCTGGTGGTAATGTAGGTCAGCCCTGGGACTCGTGGGCTTTGGGCCAAC
GGACAGCCCACATCCCTCTGGGGGTCACCCTTTCTCTGAGGTCGAGTGTCGTGAAGGGTG
GCCTCCTGAGGTGGGAAAGCCCAATGTCGAAGGACCTGTACTGAGAATTTGTTGCTTAGG
CTGCTTAGGATCCATGTTGTCACCTCCAGGGTGGTGGGATCTTGGGACCAAGCAAAGGAG
AGGGCACCATGTGGCTGCCAATGGCTATGTGTGACTGGCTCTGTGTCTGAGAGGTGTGTG
GATGGGGACCCACCAGAGAAAGCAAGTGGCCCTGCAGCCCCAAGATGTGATTTCTGGTGC
AGGCTTGGAGAGGGTGCCTGTACCTGCTCCCACCACGCCCAGGGGCAGGCTTTGCCACTG
CATGTCTGCAGTGCCACGTGGCATCTGGGCCAGCCACCTTGGTTGGCCGTGACCTGGCTG
GTAGCCCGTGCCTGTGCCCAGTGTTCCCAGGGCTGCCCTGGGGTCTTGCGGGGGAGCTGT
TTTGGGCAGTGGAAATGCTCTTGGGGCCTGCAGTATGGCACAGCCTGGGCATTTTGCCTG
AGCCCAGTGACCTGCCTGCCTTGTCCTTCCTGGGTTCGGTGGCAGGGAGGGCCAAGGGTG
CCCTACATTGGTGACAAGTCAATATTTTGCATGGATCTCATCACGTGTCCATGGAGGTGG
GGGCAAGCGTGAGCTGGCACGCACCCCATTCTCCCCATGGAGGGTGGTCACATGTACTCC
ACCTGTGTCCCTAGATGGTGAGACTGGAGGAAGACTTCCATTGGGCCCACTTTTCATGGG
ACAGTGTCCATCAGCCAGGTGCTCAGCCCCCAGTGCATTGAAGATCCAGCCCATCCTGGC
ACCCTAGTCTCCTGCACTGAGCTGTGCTGAGCACATCTGGCTTCCACTGGAAGTTTTTTT
TGCGAGGAGGGGCTTCCCTGGGTTGGGTCAATGATGAGAACCTTATATTGTCCTGAAGAG
AGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCTAGGGGAGAA
TTTTGGAAGAGGATTATGGGATCCCAAGGTCCCCAACAAGGCCACTGCATTTTGGGCTAG
AGACCTGGAGGCTCTTAAGAGCATCTGGAGGTGGCCCAACCTGTCTCTGCTCCTTCGTGA
TGCAGCCAAGGCTCCCTGTTGGGATTGGTGTTGGTGCTCCAGTTCCCTGGCATGGGGAAC
GTTGGTGGCTCCTTCCTGAGCTCCTGTTCTCGCCTTGTGTCTTTCAGTGAGCTCTGCCAC
CCAGGACATCCCCCTGGCATTGACTGGCATAGGTGAGTGGATCCTGCTGGGGTCATTGGT
CATGAGCCAGTCCATGTGGAATCCCCAAGGTTCAGCCTTTGGGCCACAAAAGTTTTCTCA
GGGAGCAGACCTGAATTTCACCTGGGAGGGAAGGGTTGTCCTGGAGGGTGGCTTTTTTGG
GAACCTAACCCAAGGAGGACCCATTCCCTGAAGCCCTGCAGGGGTGATGGTGGTCCAGGC
AGGAAAGGGTTCCTTCTGCTCAATGCAGGGCAACACCCAGCTAAGATGCGGTGATCTGGT
AAGGCCTCCAGAACTGCCCAGGCCATATGAGGGGGGCCAGAGGGGCTACGGGGTGCCACA
GGGGTAACAGGGGAGCTCTTGGTCCTTGGAGTATGGTGCCTGAATGGACCCATGGGATTG
GGTTGTGTAGATTCAAGGATCACACCCTACCCACGGCCCTGAATGTGACTCTTCCTCTTG
AGCAATGGGCCATCTCAGTGGGTCTCCTAGAGCCTGGTCGGGGATTGGTGTTGTTTCCCT
GGGGTTGGGTCTAGGTGGAGCTCTGGCTGGTACCTGGTGGTGCTGCAGATCATCCCTGGG
ACTTTTGGGCTTTGGGCCAAGGGACAGCCCGCATCCCGCTTGGGGTCAGCCTATCTCCAT
GGTCAAGTGTCATGAAGGGTGGCCCCCTGAGGTGAGAAGGCCTACTGTCAAGGGATCTGT
CCCAGGATTTTGTTGCTCAGGCTGCTTCTGAGCCATGGCGTCACATCCACAGTGGCAGGG
TCTTGGGCTTGAGCATAGCAGAGGGCACCATGTCGTTCTGGATTGGCCAAGTATGGCCTA
GCTCTGTGTGCGGGAGGTGTGCAGAGCATGGACGGTGACCCACCAGAGAAAGCACGTGGC
CCTGCATCCCAGGCTGTGATTTCCAATGCACACTTGGAGAGGGTGTCTTGATTTGTGCCC
ACCATGCCCAGGGGCAGACTACGTGATAGCCAGGTCTGCAGCCTGAGCCACGTGTGGCAT
CTGGGCCAGCCACCTTGGTTGGCCGTGAGCTGGCTGGTGGCCTTGGCCTGTGGCCAGTGG
TGCCAGGGCGGCCCTGGGGTCATGTGGGGGAGCCATCTTGGGCAGTGGAGGTGCTGTCAG
GGCCTGCAGTACAGCGCAGCCTGGGCATTTGGCCTGAGCCCAGTCACCTGCCTGCTCTGT
TCCTCCAGGGTTTGGTGGCAGGGAGGGCCAAGGGTGCCCCGCATCCGTGACGACTCAGTA
ATTCACATGGATCACATCACTTTTTTCCTTGGAGGGCAAGCAAATGTGAGCCCCCACCCC
CCACTGCCTTCCCCACATGGAGGTCATTTTGGACACATATCCTCCTCTGGTTCCCCTAGA
TGGTGAGACTGGAGGAAGACTTGCATTGGGCCCACTGTTCCTGGGCCAGTGTCAGTCAGC
CAGGTTCCCAGCTCCAAGTGTGCTGAAGCTCAGGCCCTTCCTGGCACCCTCAGCTCCTGC
ACTGAGCTGGGGTTACATCCGGGTTCCACTGTTTGCATGCAAGGGGAGGGGTGTACCCTG
GGTTGGGCTGATGATGAGAACCTTATATTGTCCTGAAAAAAGGTGATGACTTAAACATCA
TGCTTAATAGTATTATGCTGAAGCCCAAGCTAGGTGAGAATTTTGGAAGATGAGGCTGGG
ATCCTGAGATCCCCGGCAGGGCCACACTTATTTTGGGCTGGAAAATTTCAAGACCTGAAG
CGCATCTTGTGGGGGGGCAATCCTGTCTCTGTGCTTCTCCGTGAGGCAGCCAGGCTCCCG
TTGCGGGCTTGGTGTCCATGCTTCGCTTCCCCAGGGGTGGGGCAATTTGGCATCCTCTTC
CTGAGCCCTCCTTCTTCCCTGTGTCTTTCAGTAAGTTCTTCTGCCCAGGTGGGGCCCCTG
GCTTTGAGCGGCATGGGTCCGTGCATCCTGTCAGGGTCATGGGCCATGAGTGAGGCAGCA
TCGGTTCGTCGAGAGTCAGCCTTTGGGCCACTGGGGTTTTCTCAGGGAGCCAACAGGTTA
CCCATCGGGAGGGATGGTTCCTCCAGGAGGGTCGCTTCCTTGGGAATCTGACCCTAGGAG
CACGCATTTCCTGAAGCTCTGTAGGGTGATGGTGGTCCAGGCAGGAAAGGGTTCCTTCAG
CCCAACATAATGCAGTTCCCAGCTGAAACTCGGTGGCAGATCAGGCTCAAGGACTGCTCG
GGCCACATGATGGGGGCGACAGGGGATTTGGGGTGCCCTGGGGGTCATGCTGGAGTTCTT
GCCCCAAGAGGGGTGGGTGATAGGGCCCATGCGATCAGGCTGCGGAGATTCAAGGAATGC
TACCCACCCATGGCCCTGAATGGGACCGACCCTGTTGAGCAATGGGCCATTTTAATGGTG
CCTCCTTGAGCCTGGTAGGGGGTGGCATTGTTTCAATGCAGTTGGGTCAAGGCTGAACTC
TGGCTGGTGCCCGGTGGTGCCCACATGGGCTTTGGGCCAAGGGGGCAGCTCATATCCCGC
TGGGGTCACCCCTTCCTTGAGATTCAGTGGCAGGAAGGGTGTTCTCCTGAGGTGGAAGAC
CTGCTGTCAAGGGACTTGTCCTGGGAATTTGCCACCTAGGCTGCTTCTGAGCCATGGGGT
CACCTCCAGGGTGGCAGGGTCTTGAGCCCAGGGAAAGGAGACACCATATGGTTTCTGACT
GGGAGTGTGGCCCGGCTCTGTGTGTGGGAGGTGTGCAGGGCATGGATGGGGACCCATCAG
AGAAAGCATGTGGCCCTGTAGGCCCCCAGGCTTTGATTTCTGGTGTGTGCTTGCAGTGGG
CACCAGGGCAGCCCTACCATGCCCAGGGGCAGGCTCTGTGACTGCCAGGTCTGGAGTGGC
TCCTGGCATGAAGACCACCCTCCTTGGTTGGCCATGAGCAGGTTGGTTGCCCTAGCCTGT
GCCCTGTGGTCCTGGTGCAGCCCTGGGGTTGTTTGGGGGAGACAGCGCAGGCAGTGGAGG
TGCTCTCAAGGCCTGCAGTAGGGCTCAGCCCAGGTGTCTTGCCCGAGCCCAGTAACCCAC
TTGCCCTGTCTTTCCAGGGTTTGGTGGCAGGGAGGGCTAACTGTGTCCCGCGTCTGAAAT
GGATCAGTGTTCTGCATGGATCCCATCACAAGGGTATCCCCTACCCACCTTCTGTGCATT
GTTATGTGAGGCCCTGGTTGGACACATGTCCTCCTCCTGTCCCTGCAGATGCTGACCCTG
GAGGAAGACTTGTGTCGGGCCCCCAGGCCCCAGGCCAGTGTCCATCAGCCAGGTGCTCAG
CTCCCAGTGCGCTGAAGCTCAGACCCTTCCTGGCACCCTGGCGTCCAGCACTGAGCTGTG
GTGAGCCCATCCGGGTCCTGCTGGATGCATGCATGGGGAGGGGGCTGCCCAGAGTTGGGT
CAATGATGAGAACCTTACATTGTCCTGAAGAGAGATGATGACTTAAAAATCATGCTCAAT
AGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAGGACGGCTGGGATCCTGA
GATCCCAGGCAGGGTCACTGTATTTTGGGCTGGAGACCTGGAGGCCCTAAAGGGCATCTG
TAAGGGGGCCCAGCCCTGTCTCTGTGCTCCTCCGTGAGGCAACCCACACTCCCTGTGTGG
GCTTGGTGTTGGTGCTCTGGTTCCCCAGGGACAGGGCGGGTTGGTGGCTCCTTCCTGAGC
CCCTATTCTCCCTTTGTGTCTTTCAGTGAGCTTTTCCACCCAGGTGGGCCCCCTGGCATT
GACCGACATAGGTGAGTACATCCTACTGGGATAATGGGCCACTAGATAGTCTGTGTGGGG
TTGCTGAGGTTTAGCCTTTGGGCCACAAGGGTTTTCTCAGGCAGCCAACCTGAATTCCCA
CCTGGGAGAGATGGGTTCTCCAGGAGGCAGCTTTTTTGGGAATCAGACCCAAGGAGGACG
CCTTCCCTGAAGCCCTGCAGGGGTGATGGTGGTCCAGGCAGGAAAGGGTTCCTTCTGCCC
AACTCGGGGCCCAATGCAGGGCAGTGCCCCCCTGAGAATTGGTGCTCTGGTAAGGGCTCG
AGGACTGCCCAGGCCACATGAAGGAGGTCAGAGGGGCTATGGGGAACCATGGGGGCAACA
GGGGAGCTCTTGGCCCCCGGAGTGTGGTACATGAATGGGCCCATGGGGTTGGGTCACGGA
GATTCAAGGATTGCATCTCACCCACGGCCCTGAATGCGACCATCCCTGTTGAGCAATGGG
CCATCCCAGTGGGTCTCCTGGAGCCTGGTGTGGGGTGGCATTGTTTTCCTGGGGTTGGGT
CAAGGCGGAGCTCTGACTGGTACCTGATGGTGCTGCAGGTCAGCCCTGGGACTCGTGGGC
TTTGGGCCAAGGGGCAGCCCGCATCCTGCTGGGGGTCGCCCTTTCTCCGAGTTTGAGTGT
CGTGAAGGATGGCCTCCTGAGGTGGGAAGGCCCACTGTCAAGGCACCTAGACTAGGAATT
GTTCCTCAGGCTGCTTGGGAGCCATGGTGTCACCTCCAGGGTGGCGGGATCTTGGGACTA
AGCAAAGGAGGGGACACTACGTGGCTCCCAATTGGCCATGTGTGGCTGGCTCTGTGCCTG
GGAAGTGTGTGGAGTATGGATGGGGACCCACCAGAGAAAGCAAGTGGCCCTGCAGTCCCA
GAATGTAATTTCTGGTGTAGGCTTGGAGAGGGTGCCTATATGCATGCCCACCATGCCCAG
GAGCAGGCTATGCCACTTCAGGGTCTGCGGTGGCACCTGGCATATGGGCCAGCCTCCTTC
GTTGGCTGTGACCTGGCTGGTGGCCTGTGCTTGTGCCCAGTGGTCCCAGGGTAGCCCTGG
GGTCGTGCAGGGGAGCCGTTTTGGGCAGTGGATGTGCTCTCGGGTCCTACAGTACAGCAC
AGCCTGGGTGTTTTGCTCAAGCCCAGTGACCTGCCTGCCTTGTCCTTCCTGGGTTCAGTG
GCAGGGAGAGCCAAGGGTGCCCCACATTGGTGACGAGTCAGTATTTTGCATGGATCTCAT
CACACGTGACCATGAAGGACGAGCAAGCATGAGCTGGCACCAGCCACCCCCTTCTCCGCG
TGGAGGGTGGTCACATGTCCTCCACCTGTGCCCCCAGATGATGAGACTGGAGGAAGACTT
CCATTGGGCCCACTTTTCCTGGGCCAGTGTCCATCAGCCAGGTGCTCAGCCCCTGGTGTA
CTGAAGCTCCAGCCTTTCCTGGTGCCCCAGTCTTCTGCACTAAGCTGTGGTGAGCACATC
CGGGTTCCACTGGATTTTTGTGCGGGGAGGGGGTTTTCTACATTGGGTCAATGATGAGAA
TCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTG
AGGCCCAGCCTAGGTGAGAATTTTGGAAGGGGATTATGGGATGCCGAGGTCCTCAGCAAG
GCCACTGTATTTTGGGCTAGAGACCTGGAGGCTCTGAAGGGCATCTGGAGGTGGCCCAAC
CTGTCTCTGCGCTCCTCCATGAGGCAGCCCAGGCTCCCTGTGCAGGGTTGGTGTTGGTGC
TCCTGTTCTCTGGTGTGGGGAATGTTGGTGGCTCCTTCCTGAGCCCTCATTCTCACCTTG
TGTCTTTCAGTGAGCTCTTCCACCCAGGAGGGCCCCTTGGCATTGACTGGCATAGGTGAG
TGGATCCTGCTGGGGTCATTGGTCATGAGCTAGACCGTGTGGGGTCCCCGAGGTTCAGCC
TTCAGTCCACAAGGGTTTTCTCGGGGAGCGAGCACTCTGTCATGTCCACCTGGGAGGGAA
GGGTCTCTCACTGGAGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCCACCCATGGCCCTGAAAGTGACCGTCCCTATTGAGCAATGGGCCATCCCACCGGGTTT
CCTGGAGTCTGGTGCAGGGCGACGTTTTTTCCCTGGGGTTGGGTCAAGGTGGAGCTCTGG
TACCTGGTCATGCTGCAGGTCAGCCTTGGGACTCGTAAGCTTTGGGCCAAGGGACAGCTG
GCATCCTGCTGGGGGGTCACCCTATCTCTGGGGTCGAATGTCACGAAGGGTGGCCTCCTG
AGGTGGGAAGGCCCATTGTCGAGGGACCTGTCCCAGGATTTTGTTGCTCAGGCTTCATCT
GAGCCATGGTATCACCTCCAGGGTGACAGGGTCTTGGGCCCAAGCAAAGGAGAGGGCACC
ATGTCGCTCTGAGTTGGCCAAGTGTAGCCTAGCTCTGTGGTGGGAGGTGTGCAGAGCATG
GCTGGTGACCCACCAGAGAAAGCACGTGGCCCTGCAGCCCCAAGCTGTGATTTCCAGTGC
ATGCATAGAGAGGGCATCTTGATGTGAGCCCACCACACCCAGGGGCAGACTACGTGACTG
CCAGGACTGCAGTGGCATATGGCATCTGGGCCAGCCTTCTTGGTTGGCCATGACCTAGCT
AATGGCCCTGGCCCGTGCCTTGGGGTCATGCAGGGGAGCCCTCTTGGACAGTGGAGGTCC
TCTCAGGGCCTGCAATATGGCGCAGGCTGAGCATTTGGCCTGAGCCCAGTGACCTACCTG
CCCTGTCCTTCCAGGGTTGGGTGGCAGGGAGGGACAAGGGTGCCCCATGTCAGTGACAAG
TCAGTATTTCACATGGATCTCATCACATGTGTCCATGGAGGACGAGCAAGCGGGAACTGG
CACCCACTACTTCCTTCCCTACATAGAGCCCATTTTGGACACATGTTCTCCACCTCTCTC
CCAGATGGTGAGACTGGAGGAAGACTTGTGTTGGGCCTGCTGTTCCTGGGCCAGTGGCCA
TCAGCCTGTTGCCTAGCCCCTGATGCGCTGAAGCTCAAGCCCTTCCTCACGCCCTGGTCT
TCTGCACTAACTGTGGTGAGCACATCCGGGTCCCGCTGGATGCATGCAAGAGGTGGTTGG
TCCCGTGGGTTGGGTCGATGATGAGAACCTTATGTTGTCCTGAAGAGAGGTGATGACTTA
AAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAACTTTGGAAGAGGA
TGCTGGGATCCTGAGATCCCAGGCAGGGCCACTATATTTTGGGCTGGAGAATTCAAGGCC
CTGAAGGGCCTCTCAGGGGGTGCCACCCTGTCTCTGTGCCCCTCTGTAAGGCAGCCCAGG
CTCCCTGTGTGGGCTTGGTGTCTGGTCTCTGGTTCCCCGGGGGTGGGGCATGTTGGTGGC
TCCTTCCTGAGCCCGCTTTCTCCCCCATGTCTTTCAGTGAGCTCTTCTGCCCAGGTGGGG
CCCATGGCCTTACACGACATAGGTGAGTGTATCCTGTTGGGGTCATGGGCCATGAATGAG
GCAGCATGGGGCCATTTAGGGTCAGCCTTCGGGCCACTAGAGTTTTCTCAGGGTGCCACT
GGGGAGGGAACGTTTCTCCAGTAGGGTCACTTCCTTGGAAATCTGATCCTAGGAGCACGC
ATTTCTTGAAGTCCTGCAAAGGTGATGGTGGTCCAGACAGGAAAGGGTTCCTTCAGCCCA
ACATAGAACAGCTCCCAGCTGAAACTCAGCGGGCTGGTCAGGCCTCAAGGACTGCCCAGG
CCACATGAGGTGGGCAACAGGGGCTCTGGGGCAACCTGGGGGTCATGCTGGAGTTCTCCT
TCTCTGGACAGTGGTGGGTGATTGGGCCCACGCAGACAGGCCCTGGAGATTCAGGACTGC
ACCCCATCCATGGCCCTGAATGGGACCGACCCTGTTGAGTAATGGGCCATCTCAGTGGTA
CCTCCTTGAGCCTGGTAGGGGGAGGCACTGTTTCAATGCAGTTGAATCAAGGCTGAGCTC
TGGCTGGTGCCTGGTGGTGCTGCAGGCAGCCCTGGGGGTTGTGGTCTTTGGGACAAGGGG
TAGCTCACATCCCACTGGGGTCTCCCCTTCCTTGAGATTCAGTGGCCACAAGGGTGTCCT
CCTGAGATGGGAAGTCCTGCTGTCGAGGGACCTGTTCTGGGAATTTGCCACACAGGCTGC
TTCTGAGCCACGGGGTCACCTCCAGGGTGGCAGGGTCTTGATCCCAAGGAAAGGAGAGGA
TACCATGTGGTTTCTTATTGACCAAGTGTGGCCTGGCTTTGTGTGTGGGAGGTGTAACGC
AAGATGAGGACCCACCAGAGAAAGCACGTGGCTCTGGAGGCCCCCAGGGTTTGATTTCTG
GTGTGTGCTTGGAGAGGGCACCAGGTTGGGCACCCACCACGCCCAGGGCAGGCTCTGCGA
CTGCCAGGTCTGCATTGGCTCCTGGTGTCAGGGCCAGACTCATTGGTTGGCCATGAGCAG
GTTGGTTGCCCTGACCCATCCCCATGGTCCCAGTGTGGCCGTGGGGTTGTTCGGGGGAGC
CGGCTCAAGCAGTGGAGGTGCTCTTAGGGCCTGCAGTAGGGAACAGCCCAGGCATCTTGC
CTGAGCCCAGTAACCTGCCTGCCTTGTCTTTCCAGGGTTTGGTGGCCGGGAGGGCCAATG
ATGCTCTGCGTCTGTGTTGGATCAGTGTTCTTCATGGATTCCATCACATGGATATCCCCT
ACCCACCTTCCCCTTGCTCATACGTGAGGCCCTGGTTGGACACATGTCCTTCTCCTGTCA
CCCCAGATGGTGAGCCTTGAGGAAGACTTGTATTGGGCCCCCACAGGCCCCAGGCCAGTG
TCTGTCAGCCTGGTGCTCACCCCCAGTGCGCTGAAGCTCAGACCCTCCGTGGCACCCTGG
TCTCCTGCACTGAGCTGTGGTGAGCACATTCAGGTTCCGCTGGATGCATGCATGGGGAGG
GGCTTGCCCTTGGTTGGGTCAGTGATGAGAACCTTCTATTGTCCTGAAGAGAGATGATGA
CTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAACCTAGGTGAGTATGTTGGAAG
AAGACACTGGGATCCCGAGATCTCCAACAGGGCACTGTATTTTGGGTTGGAGACCTGGAG
GCCCTGAAGGGCATCTGGAAGGAGGCCCAACCCTGTCTCTGTGCTCTTCCTTGAGGCAGC
CCAGGCTACCTCTGCGGGCTTGGTGTTGGTGCTCCAGTTCCCTGGGGCCAGGGAACATTG
GTGGCTCCTTCCTGAGCCCCCATTCCTCCCTTGTGTCTTTCAGTGAACTTTTCCTCCCAG
ATGGGCCCCCTGGCATTGACTGGCATAGGTGAGTGCATCCTGCTGGGGTCATGGGCCATC
AGCCAGGCCATGTGGGGTCGCTGAGGTTCAGCCTTTGGGCCACAAGGGTTTTCTCAGGCA
GCCGACCTGAATTCCCACCTGGGAGAGACGGGTTCTCCAGGAGGGCAGCTTTTTTGGGAA
TTAGACCCAAGGAGGATACCTGAAGCCCTGCAGGGGTGACGGTGGTCCAGGCAGGAAAGG
GTTCCATCAGCCCCAGGCAAGGCAGCTCCTAGCTGACACTCGGTGTTCGGGTCAGTCCTT
GAGGACTGCCTGAACACGAGGGGGTCCAGAGGGGCTCTGGGTGCCACGGGGGTCACATGG
GAGCTCTCAGTCCCTAGAGTGTGGTGTGTGAATGGACCCTTAGGGTTGGGTCTTGGAGAT
AAAAGGATTGTGCTCCACCCATGGCCTGGAATGTGACCGTCCCTGTTGAGTAATGGGCCA
TCCCAGTGGGTCTCCTGGAGCCTGATGGGAGGTGGCATTGTCTTCCTGGGGTTGAGTCAA
GGCAGAGCTCTGGCCCATACCTGGTTGTGCTGCAGGTCAGCCCTGGGACTCGTGGGCTTT
GGGCCAAGGGGCAGCCTGCATCCCGCTGGGGATTACCCTATCTCTGAGATCAAGTGTCAT
AAAGGGTGACCTCCTGAGAAGGGAAGGCCCACTGTCGAGGGACCTTTCCTAGGAGTTTGT
TGCTCAGGCTGCTTGGAATCCATTGTGTCACCTCCAGGGTGATGGAGTTTTGGGCCCAAG
CAATGGAGAGGGCACCATGTGTCTCCTGATTGTTCAAGTGTGTCGGAGATATGCGGAGTA
TGGATGGTGGCCCACCAAAGAAAGCATGTGGCTCAAGCTGTGATTTCCAGTGCGTGCTTG
GAGAGGGCGCCTGTATGCGCGCCCCACATGCCCAGGGTAGGCTATGCAACTGCCAAGTCT
GCAGTGGCGCATGGCATCTTGGCCAGCCTTCTTGGTTGGCCATGACCTGGCTAATGACCC
TGGCCTGTGCCCAGTGATTCCAGGGAAGCCCTGGTGTCATGCAGCGGAGGCCTCTTGGGC
AGTGGAGGTGCTCTTAAAGCCTGCAGCATGGCACTAAAGCCTGCAGCATGGCACGGCCTG
GGCATTTATCCCAAGCCCAATGAACTACCTGCCCTGTCCTTCCAGGGTTCGGTGGCAGGC
AGGGCCAAGGGTGCCCCGTGTTGGTGACAAGTCAGTATTTCACATGGCTCTCATCACATG
TGTCCATGGAAGATAAGCAAGTGTGAACTGGCACGCCCTACCTCCTTCCCTACATGGAGG
TAACTTTGGACACATGTTCTCCACCTCTCTCCCAGATGGTGAGACCGGAGGAAGACTTGC
ATTGGGCCTGCTGTTCCTGGGCCAGTGGCCATCAGCCTGTTGCCTAGCCCCTGATGCGCT
GAAGCTCGGGCCCTTCCTCGCGCCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCCG
GGTCCTGCTGGATGCATGCACGAGGTGATTGGTCCCCTCAGTTGGGTCGATGATGAGAAC
CTTATATTGTTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGA
GGCTCAGCCTAGGTGAGAATTTTGGAAGAGGATGCTGGGATCCCGAGATCCCAGGCAGGG
CCACTATATTTTGGGCTGGAGAACTTGAGGCCCTGAAGGGCATCTCAGGGGGGCCCAACC
CTATCTCTGTGCCCCTCCATGAGGCAGCCCAGGCTCCCTGTGTGGGCATGGTGTCCGGGC
TCTGGTTCCCTGGGGGTGGGGCATGTTGGTGGCTCCTTCCTGAGCCTGCTTTCTCCCCCA
TGTCTTTCAGTGAGCTCTTCTGCCCAGGTGGGGCCCATGGCCTTAAGCGGCATAGGTGAG
TGTATCCTGTTGGGGTCATGGGCCATGAATGAGGCAGCATGGGGCCATTTAGGGTCAGCC
TTCGGGCCACTAGGGTTTTCTCAGGGTGCGACCGGGGAGGGAACGTTTCTCCAGTAGGGT
CACTTCCTTGGGAATCTGACCCTAGGAGCATGCATTTCGTGAAGCCCTGCAGAGGAGATG
GTGGTCCCAGCAGGAAAGGGTTCCTTCAGCCCAACATAGAGCAGCTCCCAGCTGAAACTC
AGCGGGCTGGTCAGGCCTCGAGGACTGCCCAGGCCACATGAGGTGGGCAACAGGGGCTCT
GGGGCAACCTGGGGGTCATGCTGGAGTTCTCCCTCTCTGGACAGTGGTGGGTGATTGGGC
CCACGCAGACAGGCCCTGGAGATTCAGGACTGCACCCCATCCATGGCCCTGAATGGGACC
GACCCTGTTGAGTAATGGGCCATCTCAGTGGTACCTCCTTGAGCCTGGTAGGGGGAGGCA
CTGTTTCAATGCAGTTGAATCAAGGCTGAGCTCTGGCTGGTGCCTGGTGGTGCTGCAGGC
AGCCCTGGGGGTTGTGGTCTTTGGGACAAGGGGCCAGCTCACCTCCCTCTGGGGTCTCCC
CTTCCTTGAGATTCAGTGGCCGAAAGGATGTCCTCCTGAGGTGGGAAGTCCTGCTGTCGA
GGGACCTGTTCTGGGAATTTGCCACACAGGCTGCTTCTGAGCCACGGGGTCACCTCCAGG
GTGGCAGGGTCTTGATCCCAAGGAAAGGAGAGGACACCATGTGGTTTCTTATTGACCAAG
TGGGACCTGGCTCTGTGTGTGGGAGGTGTAGGGCAAGATGAGGACCCAGCAGAGAAAGTA
CATGGTCCTGGAGGCCCCCAGGCTTTGATTTCTGGTGTGTGCTTGCAGAGGGCACCAGGG
TGGGCACCCACCATGCCCAGGGTAGGCTCTGCAATGGCCAGGTCTGCATTGGCTCCTGGT
GTTAGGGCCAGACTCGCTGGTTGGCCATGAGCAGGTTGGTTGCCCTGACCCATCCCCATG
GTCCCAGTGCGGCCCTGGGGTTGTTCGGGGGAGCCGGCCCGAGCAGTGGAGGTGCTGTTG
GGGCCTGCAGTAGGGCATCTTGCCCCAGCCCAGTGACCCACTTTCCCTGTCTTTCCAAGG
TTTGATGGCCAACAGGGCCAATGGTGCCCTGTGTCTGTGATGAGTCAGTGTTCTTCATGG
ATTCCATCACATGGGTATCCCCTACCCACCTTCCCCTCGCTCATATGTGAGGCCCTGGTT
GGACACATGTCCTTCTCCTGTCACCACCCCAGATGGTGAGCCTGGAGGAAGACTTGTATT
GGGACCCTACAGGCCCCAGGCCAGTGTCTGTCAGCCTGGTGCTCATCCCCCAGTGCGCTG
AAGCTCAGACCCTCCCTGGCACCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCTAG
GTTCTGCTGGATGCATGCATGGGGAGGGCCTTGATTGGGTCAATGATGAGAACCTTATAT
TGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACACTGAGGCCCAG
GCTAGGTGAGAATTTTGGAAGAGGGCGCTGGGATGCCAAGATCCCCGGCAGGGCCACTAG
CCACTGTATTTTGTACTGAAGAACTTGAGGCCCCAAAGGGCATCTCAGGGGTCCTAGCCC
TGTCTCTGTGCCCCTCCGTGAGGCAGCCCAGGCTCCCTGTGTTGACTTGGTGTCCAGGCT
CTGCTTCCTGGGGATAGGGCATGTTGGCAGCTCCTTCCTGAGCCCACGTTCTCCCCCGTG
TCTTCTAGTGAGCTCTTCTGCCCAGGTGGGGCCCATGCCCTTAAGCAGTATAGGTGAGTG
TATCCTGTTGCGGTCATGGGCCATAAATGAGGCAGTGTGGGGTCATCGATGTTCAGCCTT
CAGGCCATTAGGGTTTTCTCCGGGTGCCCCCGGGGAGGGAACATTTCTCCAGTAGGGTCA
CTTCCTTGGGAATCTGACCCTAGGAGCACGCATTTCCTGAAGCCCTGCAAAGGTGATGGT
GGTCCAGGCAGGAAAGCGTTCCTTCAGCCCAACATACAGCAGCTCCCAGCTGAAATTTGG
TGGGCTCGTCAGGCCTTGAGGACTGCCCAGGCTTCATGATGGGGGACACAGAAGCTCTGG
GGCTCCCTGGGGCTCACACTGGAGTTCTCCCTCCCTGAAGAGTGGTGGGTGATTGGGCCC
ACAGTCAGGTGGCGGAGATTCAAGGAATGCCCCCACCCCTGGCCCTGAATGGGACCAACT
CTGTTGAGTAATGGGCCATCTTAATGGCGCCTCCTTGAGCCTGTTGGGGGTGGGTTGCTG
TTTCAATAAGGTTGAGTCAAAGCTGAGCTCTGACTGGGCGCCTGGTGGTGCTGCAGGCCG
GCCCTTCTTTGGGCCAAGGGGGCAGCTTGTGTCCCGCTAGTGTCATCCCTTCCTTGAGGT
CCAGTGGTGGAAAGGGTAGCCTCCTATGGTGGGAAGGCCTGCTGCTCAGGGACCTGTCCT
GGAAATTTGCCATCCAGGCTGCTTCTGAGCCATGGGATCACCTCCAGGGTAGTGGGGTCT
TGAGTCCAAGAAAAGGAGAGGACACCATGTGGTTCCTGATTGGCCAAGGCTCCTTGGTTG
GCCAGGAGCAGCTTGGTTGCCCTGGCCCATGCCCCATGGTCCTGGTGTGGCCCTGGGGTT
GTTCAGGGGAGCTGTCCCAGGCAGTAGAGGTGCTCTCAGGGCCTGCAGTAGAGTGCAGCC
CAGGCATCTTGCCCCAGCCCAGTGACCCACTTACCCTGTCTTTCTAAGGTTTGGTGGCCA
GGAGGGCCAATGGTGCCTTGTGTCCATGTTGGGTCAGTGTTCTGCATGGATCCCCATCAT
ATGGGTATTCCCTACCCACCCTCCCTGCACTGATATGTGAGGCCCTGGTTGGACACATGT
CCTCCTCCTGTCCCTTCAGATGGTGAGCCAGGAGGAAGACTTGTGTTGGACCCCCACAGG
CCCCAGGCCAGTGTCCATCAGCCTGGTGCTAATCCCCCAGTGCGCTGGAGTTTGGACCCT
CCCTGGCACCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATGGATGCGTGCTTGGGGT
GGGGGTTGCCCTTGGTTGGGTCAATGATGAGAACCTTATATTGTCCTGAAGAGCGGTGAT
GACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGA
AGAGGACACTGGGCTCCCCGGAATGGCCACTGTATTTTGCGCTGGAGACCTGCAGGCCCT
GAGGGCCATCTGGAAGGTCCAACCCTGTCTCTGTGCTCCTCCAGGAGGCAGCCCAGGCTC
CCTGAGGGGGCTTGGTGTCGGGCTCCTGTTCCCCGGGGTTGGGGCCGGTTGGTGGCTCCT
TCCTGAGCCCCCGTTCTCCCGTTGTGTCTTTCAGTGAGCTCTTCCACCCAGGCAGGCCCC
CGGCATTGACTGGCATAGGTGAGTGGATCCTGCTTGTGTCATGGGCCATGAACCGGTCCA
TGTGGGGTCACCAAGGGTCAGCCTTTGGGATAAGAGGGTTTCCTCAGGGAACCAACCTGA
ATTCCCATCAGAGAGGTATGGGTTCTCCAGGAGGGCCGCTTTTTTGGGAATCGGACCCAA
GGAGGATACCTTCCCTGATCTCTACAGGAGTGACGGTGGTCCAGGCAGGAAAGAGTTCCT
TCAGCCCCACCCAGGGCAGCGTTCTGTTGAGACTCAGTGCTCAGGTCAGGCCTGGAGGAT
TTCTCAGGCCATCTGAGGGGGTTAGAGGGGAGCTCTTTGTCCATGGAGTGTGGTGCTTGA
ATCTGCCCTTGGGGTTGGGTCATGGAGATTCAAGGATGGTGCCTCACCCATGGCCCTGAT
TGGAATTGTCCATTGAGAAATACGCCATTCCAGTGGGCCTCCTGGAGCCTGGTGGGGGGT
GGTGTTTTTTTCCCTGGGGTTGAGTCGTGGATGGGGATTCACCATAGAAAGCATGTGGCT
CTGGAGGCCCCCAGGCTTTGATTTCCAGTGCCTGCTTGGAGCAGGCACCAGGGCCGGCAC
CCACCATGCCCAAGGGCAGGCTCTGCGACTGCCAGGTCTGCATTGGCTCCTGGCATCAGG
ACCAGCCTCCTTGGTTGGCCATGAGCTGCTTGGTTGCCCTGGCCCATGCCCCGTGGTCCT
GGTGTGGCCCTGGGGTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved