Pan_troglodytes Locus Mono:117:SNORD25
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:117:SNORD25
Pan_troglodytes
Mono:117:SNORD25
8
SNORD25
1001..1070
2070
GAGTCATGTAGCTGGTAGTGAAGGAGCCAAGCTTCAAACCTAACCAATCTGACCCTCAG
AGGTATTCTTAAGCACCATGCTGTACAACAAGTCAATGGGATAAAAGTAACTGATATCTA
ATAGATAACTAGAATTGCTTCTCAACATCACATTTTTTATTAGTAATAGTACAGTGTTCA
GTCTTCCTACACAAATACAAAATATAATGGATTATCTCAAATAACAAATTCTTCCCTCTA
GTTCTTTTGCCAAACGGGGATTGTAGGAATCGGAGCACATTAGCCAAGAACAGTTTCGCT
CAAAGTCTACACAACTGCTTAGGCTCTCATCATCTCCATATGGACCCCCTGCAAGATTGT
ATTAACATGCACAATGTATTCATAGTCTTGAGGACAACAGTTTACCACTCAATAATACTG
GAACCGCACCATACAGTCCTATGACTACTCCCTCCAGGAAGGTGCAAAATTGGAAAGAAG
TGTTGAGTGAATTGGAAATAGCCGACTTCAGGATGATTTCATTTCTCTCTTGTTGCCTCT
TTACTTACTGTTCAGCTGTGATCCTTGCTCATCCCCAGATCCGAAGATCAGAGGAAATGA
TGATCGTATTTCCAATTAGAACAAATCGTAGCTATCTTGAGCTGTATCATTAATCCTTTC
AGGGACATTTGTATTGTGTTACTCATTCTGTAGCCTAATGAGGCATAAAAGAAGAATCTC
TTTCCTTTTCCTGTATCCAAATGTAGGTCCAAATAATTGCTCCTGCTGCTAGAGACTAAG
GTTAATTTAAAGTAAAGACCCAGCTGGGGAAATGTTCACTGTCTAAGCAATGGAATCAAA
TGTGGATAGGCACTGTCATAAACCTATCACCTCGAGACTTTCCTTTTTGCAATTTGATCC
TCAATTTTGTAATGCCTATTTGCCTACTGTTTATGAGTGTCAGAATTTTCCATTCCTTAC
GGACCAATGATTTTTTTCAATAAAATTATTTAACATAGTTAGTTCCCTATGGTGAGGACA
TTTTCACAGGCTTGCACTGAGCTCTATGAGCATAAGTAATTCTGAGGAAATAAAAAAAGG
AAATAATATTTATAGTAATAACAACAATAAAAAACTGTTTAACATAACACTTTTAGTATT
TGTTAAGTCACTCTCTTATTTAGAAACACGTGCTGAACCATGCATTAGGGCTGGGGATGC
ACAGATGACTAAGGAAACATTTCTACTTTTAAAGAGTTTATAATGTAATGGGAAAAGCAA
AGAAGAGGTGCTACATTTAATAGCAATACTTCAGAATAAACATTATAAAAAATAAAAATA
TGGCAGATTATTTTTCTCACTAGTCTCTAGTGTTTCTTTTAAGCTCTTTCTAATACTAAT
CTTATTCAACAGAGGTTGACCCTGTAGATTTATCTCCCAAAACACCTGAGGAATGTGACA
TGTCCAACTAGTAATAGTGGTTTGGAGAACTTAGGTATGCTCACTTGGGGGAACATGTAT
CAGTATGTTGGTTTGAAGAGCAAACTGTTTTGAGAGAAAACACACCCAAGACATTTCATT
TTCTCCTCCCCTCTCCTTCCTCCCTCTTCACCTTTAAACTTTATTAAAATTGTGTCTTGT
AAGAATTAGCTGGAGTGCTTGTTAAACATCCAGATTTCTGGGCCCTTTCACTGGAGGGTC
TAAAGTATGCTATAAATTCACTCATTTTTTTCTGCAATCAAAAGGAAATATATATATTTT
TCCACTCTGTTTTGAATAGGATTAGAAAAGAATCCTCTGTTCGGCATTCTCAGACACAGG
AAGTGTTTTCTGGGCTGTTGCTATGTGCTTTAGCAAATTAGTCTGCCAGTCTCCTTAGGA
ACTCTGTCAGTTAGCTAGTTTGCTATTTGTGCATCCAAATTATTGATTTTGTATCAAACT
GTAAGATGCAATAATAAGAACATATTTACCAAAAGTAAGTGAGTTGAAAACCTAACCCAG
ATTTATGTTTGAAAACTACTATTATCAGAAATGAAGGGACTAGAGTTAAACCTACCCAAG
AAATGCTACTAAGTTGAAAGCCAAATAGTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved