Pan_troglodytes Locus Mono:165:SNORA75
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:165:SNORA75
Pan_troglodytes
Mono:165:SNORA75
2a
SNORA75
1001..1127
2127
TCTGTCGATTTGCAGAGGGATTCCACCGAATTCATGACTACATAATGAGTGCATATTCA
CATGAGGAAACTATCTCATACCAGGGAAAGAACATTAGAAAGGAGCAGGTAGAACAATGC
ACAGTTATCATATAGGTCCAGGAAATATTTCTGCCCATATTTCTACCAGCCAGTGTGTGA
AGACCTAGTAAAAATGAGACATTGGTTAGAATTCGCCAAAAGGTATGTCCATTAAATGAT
GGGGTTAAATTTGCTTTAGATTAAAGGCTGCCCTGAACCCGCCTATGAAAACTTAAAAGC
AAGCCTCAAAAAATAATGCAAACTAAATTAGTTATATTCCAGAAAACTAAAAATAAATAT
CTAAAGCAATTCAAGGAATTTAGCATCTGAATTCTAGCATTCAATAAAAAACTACTAGAG
ATGCAAAGAAGCAGAAAAATATGATACAAATTGGAAAAAACGGAACATGAAATGGCATAG
ATGATAAAATCAGCAGATAAGGACTTTAAAAGAAGTATTATAAATGTGTTCTCTATGTTT
GAGAATGTAAAGAAAAGCACAGCATGACAATCAAAAATGTGAATTTTTTTTAATATTACA
AAACAGAGCTCTGTAAGTCAAAAAAATCTAAAATAAGAAATAAGCTGAATCAGATTTATA
GTGGATTGGAAAATACAAAAGAAAATATTAATTACATAGCAATAGAAACTATGGGAAATG
AAATATAGAGGGAAACACCATTGATAAAAGCAAGCAGGATATCTCTAATATAAAACAACA
ATAAGTGAGCTAACATACAGATAATGGAATTTCAGAAGGAAAGGAAGTTTGAGGTGGGGG
GCAGACATACGTAATGAAGAACATTTTCTAATTTGGTGAACTACAAACTTTAGAACTTAA
ATAATCTCCAACATAACAAATATTTGGAAAACCAAACCAAGACACCTCATACTCAATTTG
AAGAATACCAGTAATAAAGAAAAAACATTAAAGCAGTCAGAGTATTCTTATTGAGCTCCT
TTCTGTCTACTGGTGGCAGTCTATGGATTTGCACAAGAGAAAACTAGCGCTATTTTACCT
TCTGTCTTTAAACAGAAGGTTTAAATTTGACTGTTTTGTGAGAAATTCTGGCATTTAAAA
AAAGGCAGCCAGAGAAAAGGAAACAATATATTCAGAGGAACAGAGGTTGGAATGACAGCA
TATTTCTCACTGGAGGTCAAGCATGTCAGAAAACAATGAATAATATATTTAAATATTGTG
AGGGCAGAGTGAACCACCTGTCAATTTGGAATTCTATATACAACAAAAAATACCTTTCAA
AAATTAAAGTTTTAACGGTTGCAGACAAGCAAAACTGAGAACATTATCACCAGCAAAGAA
TCCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCCTGTCATTTGGAATTCTATATACAACAAAAAATACCTTTCAAAAATTAA
AGTTAAAGACCTTTGCAGACAAGCAAAACTGAGAACATTTATCACCAGCAAATCCATACA
AAAAGCATGTTAAATAAAATTATTTCGGCATAAAATAAAATGAGGCTAGACGGAAATTTA
GATTTACACAAAGAAATAAACAGCACTGGAAATGGCCAATATGTGAATACATATAGAACT
AATTTTGATTTTTAAAAATCTTATTAAAATAATTAAATATATAAAGCAAAAATAACAACA
ATGTATTCTGGAATTTATAAAATGTAGAAGAAAAATACAGGACAAAAATTGCACAGAAGA
CAGGAAGAGAAATTGTAGAATTTCTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved