Pan_troglodytes Locus Mono:245:SNORA27
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:245:SNORA27
Pan_troglodytes
Mono:245:SNORA27
16
SNORA27
1001..1124
2124
CAAATTTTGGTTTCCTCAGTCTTCGTCTTCTGGGATGTAAGTGTGGCAGCATCAGCATG
AACTGGTTCTTTTCTTCCCTCTGGTCCAACAGCATCCTCGTTCTCTTTCTGAGAGTAAGG
CAAGATGTGAGGTCTATACAGGATGTGAGGTGTGAAGCTCTTTGCCAAATATGTAATCAC
GTTGTCTTGGTTAATCCTGTCTTCAGTTGAAGAATGAGAGGCAATGAGTACTTCCTGATT
TTCCAGAAAAGTAACTCCTCGGACCTGTTCTATTCCTACCGTCCCCAAAAAATTGATCAC
TTGGCAGATGCTTCCGGATGAACTACTCCTCCAACTCTGGGACTTTACATTCTCCGCTTT
TCAATCACTGTTTTGCTAAAATTTCATATAAGCGTTGACTAAGATGTTGAGGGCAAGATG
ATTTAAAAGAAAAAAACAGGCTGGTGCAGTGGCTTACCCCTGTAATCCCAGCACTTTGGG
AGGCTAAGGCGGGAGGATCACTTGAGGTCAGGAGTTTGAGACCAGCTGGGCCAGCATGGT
GAAACCCCATCTCTATTAAAAATACAAAAACTAACTGGGCATAGTAGTGGGCTCCTGTAG
TCCCAGCGACTCAGGAGACTGAGGCATGAAAATCACTTGAACCTGGGAGGTGGGGATTGC
GGTGACCCAGGATCACACCACTTGCACTCCAGCCTGGGAGAAGGAGTGAGACCCTGTCTC
GAAAAAAAAAAAAAAAAAGAAAAAAAAAAAGATTCCCCATTGAGACATTGAGACATATGA
AAAACTAACACACAGTTTATCTGGGTTACTATCATCTTTGTTAGCACATAAGCTAGGCAG
ATATATAAGATGTATCTCAATTCTACAATTACATCATTGGGGGAAAATCTAAACATTTTT
CATGGCACATGAATTGAAAGTGATTTCAAAATAGTTTTGTCAGGGAAAACATTACTTCTG
GTTTACTTACATATATTTTACTGTGTATTAAAATCTGGTAGAACCCCCTTTTCACTTTGC
CAATTGGACTTATGTCTTTATTGATCATTCAAGTGAGCAAAGGAAATACGCTTTAAAAAC
TCAGGCAAACGGTGTTTGTCTTGTATCCTGTCAGAGGAAACAAATTGAAGTAGGAAAAAA
AAAGCCTGGTAGAAAATTATTAACTCTAAATGTGGAATAATATTGAATTAACTGAGAAAA
TATATATATAATCAGCTAAAGGAAATATTTTGCTATGAATGATTAATGTTCCATAGCAAA
GTTAGAGGAATCATAAATCTAAATCTAATACTTTTAAGAATTAACCTCACTTTATCTCTA
ATAAGCTTTGTGGTCTGTGGCTTATTATTATGTTTTGTTATTTGTTAGTTATTATTAGTT
ATTATTTTGTTACTAGTTGACACATAATGATATATATTTATGGGGTATAGTGTGATGTTT
CAATATATATATATTTATTGTGTAAAAATTAAATCAGGGTATTTACCATGTCGATCACCT
CATACATTTATCATTTCTTTGTGGTGAGTACATTCAAAATTCTCTCTTCTAGCTATTTCA
AAATAAATAATACAATATTGTTGGCCAGGCACAGTGGCTCACACCTGTAATCCCAGCACT
TTGGGAGGCCGAGCTGGGCAGACCACCCAAGGTCAGGAGTTCGAAACCAGCCTGGCCAAC
TGGCAAAACCCCAGCTCTACATTTTTAGTTTCTATTTTTAACAAAACTTAGCTGGATGTG
GTGGTACGTACCTGTAATCCCAGCTCAGGGAGGCTGAGGCAGGAGAATCACTGGAACCCA
GGAGACAGAGGTTGCAGTGAGCCAAGATCGTGCCACTGCACTCCAGCCTGGGCAACAGAG
TGAGACTCCATCTCAAAAAACAACAACAACAACAACAATAAATATTATTAATCATAGTCA
CCCTATTGTGCAGTAGGACGCAAGAACTTATTCCTCCTATCTAACTGCAACTTCGTACTG
TGACATCCTCTACCTTCATACCAAAAACCTCCGCAGCCTTTGGGGAACCCTATCTCTCAG
TTTTCTTGAGATACTCTAGATCCACATAGGAGGGGGATGTGTGGTATTGTCTTCTGTGCC
TGGCTTATTTCATTTAACATAATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved