Pan_troglodytes Locus Mono:214:SNORA64
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:214:SNORA64
Pan_troglodytes
Mono:214:SNORA64
12
SNORA64
1001..1132
2132
GGTGGCATTGACAATTTAAAAATGATTTTGAAATCAGTCATTTTCTAATTCTATTTAGT
AGTAACAGTAGCACTGTAGTAATTGCTGCAGTAGTAGCAGTTAACATTTACTGAGTTCTA
ACACATAAAAAACTGTACTAAACACTACACATATATATCATTTAATCCCCAAAATAGCTA
ATGTTGGAGGTATAATTTTACAGATGAGGAAATGAAATGGCAAGAGGTTACAAAATGTAT
CCAAAGTTAGAGGACTCAAACCAAATCAGTCTGATAGCAAAGTCACTGCTTTTAACTACA
ATGTCAGTGATCTCAAAGTGTGGTCTCCAGACCAGCAGCATCAACATCACCTGAGAATGT
GTTAGGAATGCAGATTCTCAACCCTCATCCCCATCAGCTGAATCAGCAACTCTGGAGGTG
GGGACACATTTGTCACATTCTCTCTAGGTAATTCCAAAGTCCACTGACATTTGACAACCT
CTGTACTATGCTAAGCTGCATGTAGAAGAAGTACCAAACACTGAGTAAACATTAGTTGTG
CAATTAAGCAAATGCGATAACAGGAGAGAACTACCCAGCACAGCACAGAGCTCACAGTGA
GCAGTAGCTTATAATAGTTTATTTCTGTTATATTAATACCCACCACATCTGTCTATTGTG
AAGTTAGATTATTAAAAACTGTTCCTGAACTGCCATCTGCATTCTAAGTTGGGAGGGGAG
AAGCCCAGCACCCTCTACTTAGAAAGAAATTATCCTTCCAGGCCAACCAAGATCTTGAGC
AATTGTTTTTTAGCTAAAAAACTAATTCCACATTTTGTATTCATCAAAATGCCCATTGCT
TTATCTGGATTTCAGGGTAGGAGAAATCCACATATTTGACAACATTCCTTTGAATGAAAC
TAAGAAGTAATGTTGGTAGTGGTGGCCTGAGTGATACATGTGATTGTGGCAGAGATTAAT
GGTGACCAAAGAAACTTAACAAGTTTTAAAATTATAAAATAGGCCTCTCAGTTCCGCTTA
ATCACACAGGTCCAGTGTGTGCTTGGTGTCTTTTCTGGGAGGCAGAGGAAGGCTCTCCTA
ATCACAACAGACCTGCCCAGAAGGGCCTCTCTATTTCTAGGAGTATGATAGCTTTTGGGG
GGAAAAAAAAAGAAAATAGTGGATGCTGCCGGGTGCAGTGGCTAATGCCTGTAATCCCAG
CACTTTGGGAGGCTGAGGTGGGCAGATCACGAGGTCAGGAGTTCAAGATCACCATGGCCA
ACATGGTGAAACCCCGTCTCTACTAAAAATACAAAAATGATTTAGGTGTGGTGGTGGGCG
CCTGTAATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATCGCAATTATCATGTATCAAT
AAAAATTTTATTAAACTATCATTCATAGCATCCATTCTTTTCTTTCTTTTTTTTTTTTTT
TTGAGACAGAGTCTTGCTCTTGTTGCCCAAGCTAGAGTGCAATGGCACGATCTGGGCTCA
CTGCAACCTCCGCCTCCTGGGTTCAAGTGATTGATACATGATAATTGTACATATGTATGG
GATACGTGTGATATGTATTAAACATGCATACAATGTGTAATGATCAAATCAGGGTAGTTG
GGAGATTTGTCACTTCAAACATTTTTTTATTTTTTATGTTGGGAACATTCCAAATATTAT
CTTTTAGCTATTTTGAAATATACAATAAATTATTGTTAATTATAGTCACCCTACTATGCT
ATGGAACACTAGAACTTATTCCTTCTAATTGTATTTTTGCACCTTTAACCAACCTCTCTT
TATTTCCCATCCCCAACCTTTCCCAGCCTCTAGTAACTATTATTCTACTCTCTACATCCA
TGAGCTCAATATTTTTAGCTACCACATATGAGTGAGAACATGCAATATTTCCACTTCTTC
TACCCATTATTCTGGGCCTGGTTTATTTCACTTAACATAATATCTTCCAGTTCCATCTAT
GTTAATGCAAATGACAGAACTTCATTCTTTTGTGGCTGAATAGTATTCCATTGTGTATAT
GTATACAATATTTTTTTAATCCATTCATTGATGGACACTTAGGCTGATTCGATATTGTGA
CTTTTGGGATTGCTGAATTGTATGGCACATCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved