Pan_troglodytes Locus Mono:38:SNORD61
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:38:SNORD61
Pan_troglodytes
Mono:38:SNORD61
X
SNORD61
1001..1072
2072
TTCCATGCGGGCTGCGGGCTTCGTATTCATTGGCGGCCCCGGAGAAGAAGCCCTCTGAA
TGTTCCCAGCCAATGTTGGTGGTAAAAGTTAGTCCCCTGACCAGTGTCGGTGGTTCTGGG
TTGAATCCAAGTGTCGCCATTTTGTCTTTTACACGCGGTTTTTAATGACGAGTTTTAATT
AGGTTCCGCTGCAGTCACGGAGTGTCGAGTGTTAGTGTGTGCGTCCGCGTTCCGTTACCT
AATAGCAAACGATGTTGACAATTTGTTTTTATGTTTTTCGCCGGATAGTAGAATTTTCGG
TAGGGCGGGGGCTGGTGAAGAAGAGGGGCGGCATAACTTGGCTTAAACTTCACATTTCTC
CTTGGATTTAGTAGGGAATCCTAATGAGGAAAAGAGGAGTCGTTGGAAGAGGGCTTGGTG
TTAAGGTCCTGTGTCTAGCCTGTGACCTTGGGAGTCTTTTAAAACCATCGTTAGGAAGGG
TGTGATGAGTAATTGAATCTTTCAAAGGCAAGAGGACTGGAACTAAAAGTTGCTTTTTCA
AATGTTAAGCAGCTGTTGCTTAAGAACAGCTAAGGGTGATCAAGGGTAGTGGTAAAAGTT
AAGTTGGCCCTTTTAACCAGTTTTATGTAAATTGCACTGTTACTAAGCTACTTAATTCAA
ATTGCTTCCTACTGTGGCTGAGGCTTAGCTCGTTACCGTTTTCTTTAGTTATTAAGGAAC
AATGGTTTTAGTGGAAAATATGAGAAATGTGCGAAAGTAAAAGTGTCCAATAAACTTGAG
GAACTTTTTGCAGTGAGGTAATACTATTCCTTTTCAACAGACTCACCGGCCCAAAAAAAA
AAAAAATGGTTGAAGCAGATCGCCCAGGAAAGCTCTTCATTGGTGGGCTTAATACGGAAA
CAAATGAGAAAGCTCTTGAAGCAGTATTTGGCAAATATGGACGAATAGTGGAAGGTGAGT
TGTCTGGCAGTACAGGCTGGGCTATTATAATTAAAATATAAGCTATGATGAATTTGATTG
CATTGATCGTCTGACATGATAATGTATTTTGTCCTCTAAGAAGTTCTGAGCTTTCTGTTT
ACACATTTACTTTGGTTATTTCATTTGACCTAGGGTAACACTTTATTTTTCTGAAAACTA
CTTTTTAGTACTCTTGATGAAAGACCGTGAAACCAACAAATCAAGAGGATTTGCTTTTGT
CACCTTTGAAAGCCCAGCAGACGCTAAGGATGCAGCCAGAGACATGAATGGAAAGGTGAG
ATTGTCTACACAATGGATGATAACCTGTTACTAGTGCATAAAATAACATGTAGTTGCCCA
AGTCTGGTCTAGGACAGCTTTTGAGTTTTCGTTTTTTTTCAGTATATACCTGTCTGGGAT
TCACTCATCCTGTTTGTGATCCTGTTCCAAAGAGTATTCTGTAATTGCAGAACCAAATCT
AGTAGTGAGTTATATCTTATGCTCGTAACATTCTCTCAGTTCAGAATAATTATGGCATTA
CATGGTACTTTTTTTTTTTTTTTGATAGTCTCCCTCCGTTGCCTAGGCTGGAGTGCAATG
GTGCAGTGCCCACTGCAGCCTGTCTCCCGAGTTCTAAGCGATTTTTCTGCCTCAGCCCCC
CCCCCCACCCCAGTAGCTGGGATTACAGGCATGCGCGACCACGCCCGGCTAACTTTGTAT
TTTTAGTAGAGACAGGGTTTCACCATGTTGGCCAGGCTGGTCTCAAACTCCTGACTTCAG
GTGATCCAGCTGCCTCAGCCTCCCAAAGTACTGGGATTACAGGTGTGAGACACTGCGAGC
CACTGCGCCCAGCCAACATGATACATTTTATCTTGAGATCCATAAGCCATATTTTGATAA
CTTGGCTTTTGGTTTTGGCTACTAGTTTTGATAACAAGCTGATACCTACTTGGCCTTGTA
TTAAATTTTACCATACAATAATGCAGTGGGTTCACCTTATGTTTCAATCCAAATCATCAG
TATCGGTTTTAAGTATTAAGAATTTAAAGCGGAAAAGCCCCATTTATATAAACTGACTAT
ATTTGCAGTGTTTTTTCTTAAACTAATGAGCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved