Pan_troglodytes Locus Mono:314:SNORA32
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:314:SNORA32
Pan_troglodytes
Mono:314:SNORA32
21
SNORA32
1001..1121
2121
GAGGAGCCATCCCCGAGCAGACAGGGGTAAATTGGTGGTGAAATGATCACTGGGGTTCA
GACAAGTTAGATCTGATATGAATTCTGGATCCCCAAAGGGAGACACCAAGGAGGCAACTG
AATATCCGAGTCTGGAGTTGCAGAGAGGCCCGGGCTGGGGGCAGGAACGCAGGAGTCTTT
CCCATGTGGGTATCAAGACAATCTTTAATGCCGTAATGCTGGCTGGGATCTCCCAGGAAA
TGAAGCTGGAGACAAGAGCCCCATGCAGTTCCCTGGGGCACAGCAGAAAGCTCTAAGGAG
GGACAGGAGGAAAACAAGGTGAAGGGGGTGCTTGGGCTAAATCGTGGCCCCCAAAATCCA
TATGTTGAAGTCCTAACCCCCGTACCTCAGAATGTGACCTTATTTGGAAACAGGGTCTTT
GTGGAGGTGATTGAGTTCAAATGACGGCATTAGGGTGGGCCTGGTCCGATCTGACTATGT
CCTGTAAGACGAGGAGATGAGGACACAGATGCACACAGAGGGATGACCCTGTGAGGACAC
AGGGAGGAGATGCCATCTGCAAGCTGAGGAGAGAGGATTCAGAGGAACCAGCCCTGCCAA
TAACTTCATCTTGGATTTTCAGCCTCCAGGACTTTGAACCAATAAATGTACGTTGAAGCT
CCCCACCTGTGGGATTTGTTATTGCCGCTCCATACAGGTGGGGGCCTGGGAACCTGAACT
CATACAGGTCGGGGCCTGGGAACTTGGGAAAATCGTGCATCGCAGAGTGGGGCCCAGGAA
GCCACTGCTGCTGGGGGTCAAGTGAGAGTAAGGCTGGGAATGTCCCTCCTTCCCCATGAG
CGTTCTGAATTGTTTTCTGATAATAACGGAACAGATATGTTTGGAAATAGTTTAAAATCT
GGTACCGTGACTGGTGCTTCACATATTTGTTTGTCTCAAAACACACAGAGAGATAATCTA
TATAAAGAGAAAACAAGAAGACACAGACTGGAAAACAGATCTGGTTGTTACCAAGGCATT
TAGCATGCAATTTCTCATTTGCTGTGGACACGACGAGAAGAGAATTCCTCACTTGGTTTT
CTGTCTGCCACCTTGCTAGCGATCAGCCCACTGGGAACATTTTATTAACCTCTTATTAAA
CTTTTATTAGTTTTACTTCCATTGCCTAGATAATCACTGTCCAATGAACACAATGCAAGC
TAGAAAAAAAAACAAACTACTGAAAATCCAGATGGACACCTTTTGTGGGGCAGAAATGGA
ACAGAAACGCTTAGCAGCAGCAGCGAGGGACATTGCAGCCACCAGCTGAAGAAGGGCTCC
TGCCCCAGGGGTCCGGCGTGGTTTGGGTCTAGGGGTCATGGGGCCAAGAGGGCATCCAGA
GAGACAAGGAGTCAGGGTCAGAATCAGACTCTGGGAGTGCAGGTTGAAATGAGACTGCTG
CAGACCTCCCTCCTGAAATGTTTGTAGCAAACTGGTCCCCAGCAGGCCTGGGGACAAGAA
GGTGTCTCAGCAGGATGGGAAAAACTGAGATGCTGGGCCAGGGACACTCCGCTGACTTCT
AGGCAGGGGTTGCGAATGTCACGGTGAGACCTGGTCCTGGACGGAGACCAGCAGGCAGGG
GGAGGCAGTCACAGAAATCCACAGAGAGAAAAGAAATTGCATAAGGAGATGGCACTCCTC
AAATGGGGTGGGGCACCACAACTCCAGAACAAATGCCAATGCAGGCCACAGATGAGAAAA
GCCATCATTAGAATATGCATCTTAGCTGGGTGTGGTGGCACGCACCTGTAGTCCCAGCTA
CTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCAGGAGGCAGAGGTTGCAGTGAGCCA
AGATCGTGCCACTTCACTCCCGCCTGGCAACGAGTGAGACTCCATCTCAATAAATAAATA
AGTAAATAATTGAGATGGGTTCTCACTATATTGCCTAGGCTGGATTCCAACCCCTTGGCT
CAAGGGATCCTCCTGCCTCAATACAAATACCAATTTTTGTATTTGTAGTAGAGACAGAGT
TTCACCATGTTGGCCAGGATGGTCTCCATCTCTTGACCTCGTGATCTGCCCACCTTGGCC
TCCCAAAGTGCTGGGATTACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved