Pan_troglodytes Locus Mono:102:SNORA67
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:102:SNORA67
Pan_troglodytes
Mono:102:SNORA67
8
SNORA67
1001..1149
2149
TAATTCGCAATTATCCATTAAATCACCTTTTTTCCAGCAGCAGTACTGTCCTCTCTGTT
CCACATGTTCCTAATGTAACTTGAGAATAATGTTTTTTTTTCCAAGGTCTTGCATCAATC
GGGGCCCTACTTTAACCCATCTAATTTCTTACTTTCCTCCAGCATACCTTCCAGTTCACC
TGAGCTAAAATTTCTTCCTTTCTAACCCCACCCCCTCCCACCCTCAGTCTCATCTCTCTG
TCTCATAAACACACATGCACACATACACAGGTACACGTGTGTACCTTTGTACAAACATGC
ATACACACACATGCACACATACACAGGTACACATATGTATCTTTGTACCTTGCTGACAAT
TGCATTCCCAGCTCAGAGGCTTCCAACTCTTTGTCTATGCAAACTCTACTCATCTTCTAA
GCCTTGCAAAGTTACCTTGTTTCCAAAAACGTTCCCTAATTTGCAAGATACTCTGCTAGG
CACAGTTAAAGAAAAAAGATTAATTCTACATAGCCTCTATCCTCAAGGAGCTGGTAATGC
TCGCTGGTTCCTTCTCAAAGATACTAGGACGTTTCATCTCACCACAAGCACTTGATTATA
TAAAGAACATCTTGCTATTTTCTATCTCAACCATGGATTGTTAGAACATAAATCATACAT
TATTCTCCATGATCTTTGCTTTGCTATTCCAATTTAGAGGAGGAGTGGGTGACAGGGGAA
GGAAGATGTGAACACAGGGAAGGGCTCAGATAATAATTTCAGTAGCCTTCAATTCTGGGC
CTAGACCCAAGAGAATAACCAGGACTCTAAGTCACCTAGGGAAAGAATATACATCAAGGC
CCATGTACCATATGTTTAAATATTTAAAAGTATAGATCAAGCTAACAAATAAAATATGCT
CTCTCCCACCTATCTTGATGAATATTCCCTCACAACAACAAAATTGAAAAGCATGTATAA
AGCTAGGGTTTTAAATGACTAAAAGTCAAAAAATATCAACAATCCAAGGGGATTCCCTCT
CCAAGGGAACATGCAGTGCCCCTCTCAGAAAAGTAGCAACCTGGAATAGAATCTGGCATG
CCTAAGGTCTTTGAGGAATAGAGGAATAGAGGATGCTTATTTCCTCTGCCTTCCTTGGCT
GCCTACATGGACACCTAAGTCTCTTCCCCTCAGGATAGATTGTCCTCTCATGCATATGCT
GAAGAGTCGTCTTTCTTGACATAGGCCAGAGGCACTGATGTGCAGCAGGTTTCTTTAGTC
ATCAACTATGACCTTCCCACCAATAGGGAAAAGTATATCCACAGAATCAGTCGAGTTGGA
CAGTTTGGCCTTAAGGGTGTGGCTATTAACATGGTGACAGAAGAAAACAAGAGAACACTT
CAAGACATTGAGACTTTCTACAACACCTCCACTGGGAAGATGCCCCTCAATGTTGCTGAC
CTCATCTGAGGGGCTACCTAGCCCCAGCCAGGGTTCAATCTTGGGGGGTTGAGGAGCAGC
AGGAAAGGGGAAGGAAGGGAGACAAGAAGTGGACATCTTGTCTTTTTTTTCTTTGAATAA
ATGTCATTTTTTGAGGCAAAAGAAATATATATATATATATCAACAATGACTAAACATAAT
TATCATTGTCTTTTTCTAATGTTCTGTTTCTGGGCTAGTAGCAGTGTATAGATCAGTAAT
AAAAGCAAACATCGTTCATAATTACTACTCATTTATTCCATGAGCTTTATTTTTCCTGCC
TTCATTTCAGCAAAATCACTGTTATCATTGAGATTTTCATGTTTCATATTCTATTGATAG
TAATGAGATTTTAAAATATATTTGTATCAAAGTTTACAAAATTTCAATATATTTTCAACA
AATAGTAAATTTCAAAAAATAAAAAGTTTATTTTTATAATATGTTTCAAAAAGGTATTTT
TTCCAAAGCACACAAAGTAATCCATTAAAATTAAAAGACAAAAAAAGTAATTTAAAATAT
CAAAGTTTAAATCAAAATTATTTACGTAAAGCTGAATTTTATTTAATTATTTTTACTTAA
TTATATCTTACTATGTACTTTATAAAAATAAATTTATTCCCAATTCAATGTCCATCTACT
TGCCAATGAAGAATTAGTATCACATTTCACAATGTTACATCTGGATCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved