Pan_troglodytes Locus Mono:263:SNORD77
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:263:SNORD77
Pan_troglodytes
Mono:263:SNORD77
15
SNORD77
1001..1070
2070
ACCACCCCTACTTTCCTATGGAAACTCTCCTCATGCTTGGGCTCCAGCACCCCATTCTT
ACCACTACCAGTCCCCCTCTCCACACCACGGACTCCCCCTTCATTCAATCTGGGCTTTCA
TACTCTCAGCCCAGTTGTGAAATGGGACTTTTTACAACCAAAAGATTAAGAATGTACACT
ATAAATTGTGACTTTGATGAAATCAGTAATATTTCTTCATATAGGCATGAGGACCAAATT
AACTATATTCTGAACTTAGTTGGGGTTCTAAAAGGACCTGCTGGCCATGCATGGTGGGTC
ACACCTGTAGTCCCAGCACTTTGGAAGATTGAGGTGGGCGGATCACTTGAGCCCAGGAGT
TCGAGACCAGCCTGGGACAACATAGCAAAACCCTGTCTCTATAGAAAATACAAAAAATTA
GCCAGGCGTGGTGGCACATACCTGTCCCAACTACTTGGAAGCCTGAGGTAGGAAGATCGC
TTGAGCCAGGAAGGTTGAGGCTGCAGTGAAGCGTGATTGTGCCACTGTACTCCAGGCCAG
GTGACAGAGTAAGACCCTGCCTCAAAAATATAAATATAAATATAAATATAAATAAATGAA
TAAATAAAAGTACCTGCTATGTTTTAGTATTTAATCTACTTGGAACTTGTTTTTGTATGA
TATAAAATGGAGGTCTAATTATTTTCCTGACAGATATCATCATTTATTATATAATCCATC
CATATCCCACTGAATTAAAATTGCACTGTTCACATTTTATGTTCTTAAAAACAGATATCT
ATTCCTGGATTCTCTTTTCTATTCCACTGGTTTATTTGTCTATGCCCAGGCCAATATTAT
ATTGATGCTATTGTGGTATCTTTATAGTGTCTTCTGAGATCTAGTAAGCCAAGTGCACCC
TTAGTGTACTTCTTTCTACATTTATTGGCTATTTACAAGTACTTTATTCTTTCCAAATAA
ATCATCAGATAATTTAATCCAATTAAAAAGAAACCTGTTGGATACTGTGACAGTTGCATC
GTTCAGCAGATTGAGTCACGAAGAGATGTATACCATCTGTCTGATGTATCTGGGGTGGTT
GGGAAAAAAAAAACTGTTGGGATTATACTGGAATTTTTTTCTTTTTTTTTCTTTGCCCCA
GCTGCTGGGATATAATAGGAATTTTATGAATTTTATGTATATTTGTAGAGTTGTCCTTTT
TGTGATAGTGTCTTAATATTCAAGAAAGAAACAATGAAGGTCATACAATGCCTGCTCATT
ATTCAGATCTTGATTCATTTATTTCCCCAACATATATATTTGAGCACCTACTATAGGCTA
GACACTGTTCTAGATCCTGGGGATTCAACTGGGAACAAAACAAAGTTTCTGCTTTTTCAA
AAAAGCAGAAAGTTTAGTAGTGGGAGATAGGTAATAAATATAAATACACACACACACATA
TATATATGTAAATACATATGTAATACGTCAGATGGTATTAAATACTATGGCAAAAAATGA
ATCCAGCTAAAGGGGATATAGTGTGCTGGGAGGAGGGCTGTTTTTTAATTTAGTGCAAAA
GATGATGTGGTGATATTTGACACATGTATGAAGGACATGAAGGAGTCATCTGTGCATTCC
AGGTGGGGGAGACAGCAAATGCAGAGGTGGGAGTGTGCTTGGTGGGTTATGCTGGCAGAG
GAAGAGCAGGCAGCCTGGCGTGGCTACAGCAGGGTGAGCAGCCAGGACAGGGGCAGGAAG
TGGAGACAGAAAGGTTGCTGGGAGGCGCCATACCGAGTACAGCCATGGAGACCACTGTGA
GTTCTGTGGCTAAATAACTCAGGGAGAAGGGAAATTACCCTGAATTTTGAGCAGAGGAGT
GACATGATCTGATGATCTTAACAAATCATTCTGGTGGACAGGAGTGGAAGCAGGGAGACC
AGTTAGGACTCTGGCTTTGTCATGCCTGAGATGGGGGTGGCTGGGAGGAGGGTGGGGGTG
TGGGGGGTGAGAGATGGGGGATTCTGATTTGGCTGGCTTGCGTGCCATTGCAGGCCACCA
GAGGGCACTACACATACGTCCTTGGTGAGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved