Pan_troglodytes Locus Mono:280:SNORA27
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:280:SNORA27
Pan_troglodytes
Mono:280:SNORA27
5
SNORA27
1001..1126
2126
AACTACATGTGTAAATATAAAAGCCCATAATATTGCATTTTTGGTTTGTAACTCCTCTT
TTTTGCCTACATGATTTAAAAAACAAATGCATAAAACAATAATTGTAAACCTATGATAAT
GGGCACACAATATATACAGATATAATTTGTGACATTAGCAACATAATGGGAAAAGATGCA
GATGTATGGGGTAAAATCTTTATAGATATTGAAGCTAAATTGGAATTAATTCAAGCTGGA
TTGCTATGTGGTTTTTGTTTTGTCTTTTTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTT
TAGATGAGGTCTCACTATGTTGCCCAGGCTGGTTTCAAACTCCTGGGTTCAAAAGATCCT
TCTGCCTCAGCCTCCTGATTAGCTGGGATTACAGGTGCATACCCTTGTGCCTGGTGAGAC
TGTTTTAAATTTAAGATATTAGCCGGGCGAGGTGGCTCACGACTGTAATCCCAGCACTTT
GGGAGGCTGAGGCAGGCAGATCACGAGGTCAAGAGATCAAGACCATCCTGGCCAACATGG
TGAAACCCCATCTCTACTAAAAAATACAAAAATTAGCTGCGCCTGTAGTCCCAGCTACTC
CGGAGGCTGAGGCAGGAGAATAGCTTGAACCCAGGAGGCAGAGGTTGCAGTGAGCTGAGA
TCACACCACTGTGCTGCAGCCTGGAGATAGAGCGAGACTCTGTCTCAAAATAAATAAATA
AATAAATTAATTAATTAAATAAAATACATTTAAGATATTAATTGTAATCTCCAAGATGGC
CACAAGGAAAATAAGTGGGGTTTTTTTGTTTTGTCTTGCTTTTTTAGACAGGGTATCACT
CTGTCACCCTGGCTAGAGTGCAGTGGCACGATCATGGCTCACTGCAGCCTCAACTTTCCA
GACTCCAGTGATCCTCCCACTTCAGCCTCCTGAGTAGCTAGGACCACAGGCCTGCGCCAC
CATGCCTGGCCAATAGAAAAATAACCTTTAAAAATATGGAAAAACCCCTGTTCACTTTGC
CAAATGGATTTGTGTCTTTATTGCTCATTAATTGGGGCAAAGGAAATATCCTTTTAAAAC
TCAGGCAAACTGAGTGTTTGTCTTGTATCCTGTCAGAGGAAAGAAATTGAAAAAGAATAA
AAAGGAAAAAAATATCAAAAAGGTAATGTGAAAAAAATCAACACAGCACATTGCAAAAAA
TCTATTAAATACAAAAGGCAATATTAGAGGAATTAAGAAACAAAAATATATAGCCAAATA
GCAAGATGGCAGGAGTTAGTGTTTGTTATCAGTGATTACTTTAAAGGTAAATGGAATAAA
CTCCCCGATTAAATAATAGAGTTTGGAAGAATAGTTTGTTTTTTTTTTTTTGGTTGGAAG
AATAGATTAAAAAAAAAAACCTTAATTTATCTATGTGTTGTCTACAAGAGACTCATTTTA
TTTTCTTTATTTTTTTAAGAGACAGGGTCTCACTGTGTTGCCTAGGCTGGAGGTACAGTG
ATGTGATCATGGCTCACTGCAGCCTCAACCTCCCAGGCTCAAGTGATCCTCCTGCCTCAG
CCTCCAAGTAGCTGGAACTACAGGTGTGTGCCACCATACCTAGTTATTTTCATTTTTTTG
TAGCTATGGGATCTTACTATGTTGCCTAGTCTGGTTTCAAACTTCTAAACTCAAGTGATT
CTTCCACCTTGGCCTCCGAAAGTGTTGGGATTACCGGCATGAGCTGCCGTGTCCAGCCAA
GACCCACTTTAGATCCAAAGACACAAATAGGTTAAAAGTAAGAAGATGGAAAAAGATACA
AAAGAGTCTGTGGTGGCTATATAAGTATCACACCAAATAGACTGTAAGTCAAAAATTGTT
ACAAGAGACAAAGAAGTATATTATATATTCATAAAAGGTTCAATTCATCAAAAAGATAAA
ACAAATATAAACACGTATGCACCTGACAATAGACCAAATATGTGAACGAAAAATGGACAG
AAATGAAGGGAGAAATAGATAGTTCTACAGTAATAGTTGGAGACTTCAATACTCTACTTT
CTTTTCTTTTCTTTTTCTTTTTTTGAGATAAGATCTCACTATATTGCCCAGGCTGGTCTT
GAACTCCTAGGCTCAAGCAATCCTCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved