Pan_troglodytes Locus Mono:197:SNORA18
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:197:SNORA18
Pan_troglodytes
Mono:197:SNORA18
3
SNORA18
1001..1128
2128
TCCTCACAAAGTACTCAGATTAAATAAGGTAACAAATGTTCAGACCCTAGTGTTTATAC
AGGAAGGTACTGACTTCCATGTGAGGTGACTGAAGGCTAGTGAACAAGCTTCTTGGTTTC
TTTACTTAAAAAGTCCCTGATCGTAAAAATATCAACAAACATGTAATTTAGAAAGCAGAG
GACATCTCTGCTATCCTTGGCAGCTGCAAAGAAAGTCAGTCAAAAGGAATATATTATTTC
GACGTAGTCTAACTTCTATAACAAACAACTCCCCAGTTGCAGCAGCTTGACATAGTGAAA
CTGTTATTTCTTGCTCATGTCACAGCGCAGTGTGGAAGGATGGAGGGACTCTGTTCCACA
TTCATTCATGAACCCAGGCACCTTCAATCTTGTGGCTCCACCCTCATATTGGCCCTTAAA
GTTCTTTCAAGGTAGCTAATGAGAAAAAAGGCAGAAAAGAGAACGTGATGACCACACAAA
GGAAGCGTATGTAGGTCATTTCTGCAAGTGGCACGTGTTGCTCCAGCTCATATCCAATTG
GCCAGAATGCCACTGCATAGCCTTACCTGGAACACGTGGTGTCGCCCTGTGCCCAGGGAG
ACAAAAACAACAATGTTGGTGAACTTGGGCATACATTCGTCTCAAGAGCCATAAAGGCCT
GTTAGATTAGATTTGTTTGTTCTTAACTGTTTACTCGCCGTTACTCATGCATATCCTTTG
ATCTGTGTTCAGGCCTTTGATTTTACGTAAATGCCTAGGCGTACACATTTTCCTATAAGC
CAAACTTAATAATGAGAAAAGAGGTAGTCCAGAAGTCTCTTAGTGTCTAAAGTAGAAACA
AAAAGATAGCTGTTAAGACAGAAGATGAAAAATAGGGAGGCTCAGAGTGCAAAAGGTAGT
CCAGAAGTCTCTTAGGGTCTAAAGTAGAAACAAAAAGATAGCTGTTAAGACAGAAGATGA
AAAATAGGGAGGCTCAGAGTGCAAAAGGAAATGATACATTTTTTGAGGTCTTTCCCGATG
GGACTTTTCTGTAGGCTGCACATCATTGGAAACGCCTCATAGAGTTAACTCTGTGGTTTT
ACTTTACTCACAGGACTCTTGTTAGATCTGTGGGAACTACAAGACAGTTACTGCAAGTAT
GAAAAAGACAGTTACTAAATATATGAAAGACCTGATAATACTTTTTTACCTTATGTATTG
GCATATTCCACACTCTGCACTATTCTTGAGTGTGATCGCTTAGGAATGAATATGATTTGA
ACTCACTCAGGTTTAGAGAGGGTGTCAAATTGAGAACTAGGCAGATCCACCTACACTAAA
AATGACCCTAAAGTAAATTGGTTGAAGAAATTAGATCTCAAAGATTCTTGATTTTTCCAA
AGGTAAATTTTGAAATCTTCATCAGTATAGCCATATTAAAAGGAGATGATGACAGATGCC
AAAATCAAAGAATTATGGCCTGACAGGACAACTGCATTAAAATAAGCATCAGTTTCATTA
AAAAGGGCTAACTTGAAGATAAATCTTTTGAAGATAAATTTTGACTCCAGCTCTTTAGAG
GATCTAAAGTGACCTCGATGGACAGCGGAAGAACTTACAACATGGAATTCCTTGAATAAA
AATCTATTGACTTTAAATAATTTTGCCTAATGTTACATACACACAGTTAAAACGAAAACA
CCTCTTTACACTGTCAAAAAAAGAAAAAGAAAATAATAGATTTTCACATTGCCCCATTGA
TGCCATTAAAAATCTATATAATCACTAGAGTCAAGTATTAGAAATGCTATCTTCTGTGGC
CGCGTTCTCTTTCAAGGCCTATTAGTCCCTAAATTATCTCCCTGGGCACATGGCAACACT
ACATGTTCCAGGTAAGGCTATGTGTTGAGAAACAGTAGTGCTGGCTAAAGCCTCACAGTG
AAATTAACATCCAGTGAAATTAATCTATTTGCAGGCTGCAAATGCCTATAGCAGTTGATG
ACTGTGATGAAAAGTCCTTTCACTTTCACGGACTATTTCAAACTTCCAAGAGAAGTTAAG
GTGGAAACAAACATGAGCCAGACTCCCTAGTTCCCCATCTCTTTTCCTTTCTTCTGGGTC
TTATCCACATTCTGTACCCTGAAAAAGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved