Pan_troglodytes Locus Mono:134:SNORA70
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:134:SNORA70
Pan_troglodytes
Mono:134:SNORA70
4
SNORA70
1001..1141
2141
AAACTCCTGGACTCAAGCGATCCACCTTCTTCAGCCTCCCAAACAGATGGGATTACATG
AGCGAGCCACTGCGCTGGGCCTCAGCTACTTATATTAGGGTTCTACAGAGTATGGCACAT
GCTTCCCAGAAGCATTATGAAAGTAAATATGTGGATCGACAGTGGCACCCTCCCTTTATC
CAGATGTCACCTGGCTTTGTGTGGTGGTTGTACCGTACACGGAGGCACCCGAGGGAAGAG
TGGGAGTTCCAGAAAAGGTGGGTTGATGGTGGTTTCCTCACTCTTTTGCTTTCAGCACAG
TGTGATGCATTACAGTTTAAATATGGTGAGCTATATTGTCATAACTGGTTTTTAGATAAT
AGTCTCTAATTTTAATTAAATTAACTCTCATAAAAACAGACAAATGACTTAAAAAGATTT
CCTGCAACGTGTTCTCACTCATAGGTGGGAATTGAACAATGAGAACACATGGACACAGGA
AGGGGAACATCACACACCGGGGCCTGTTGTGGGGTGGGGGGAGAGGGGAGGGATAGAATT
AGGAGATATACCTAATGTTAAATGACGAGTTAATGGGTGCAGCACACCAACATGGCACAT
GTATACATATGTAACTAACCTGCGCGTTGTGCACATGTATGCTAAAACTTAAAGTATTAA
AAAAAAAAAAGATTTCCTGCAAAGAAACCGTGGATTGATGTGAAAACAATAACATGAGTA
GAAGCAAATAAGCAACAACAACAAAAACAACAACAAAAAGAGCAGACCAGTTCTACTCCT
AGAAAAAACTCTTTGCTACCCACATTGAAAGGCCAAAATAATAAGGCTCAAATGAGATTT
GATGAGAAGTCTGACAAAATAGTCAAAATTAGCAAGGAGATGGCTTGCAAGTTGTATTTA
CATCCATTATCATTAATGAGGAACCACAACTTAAGGGAATATTTTGCCTTGAAATATTAA
TGATTGTAGCATGATTTGAAAGACATTTAAAATAGTATTTCTTACAGTCAATTAAGCCAA
TCATGTTCCTTTCCTTGTAAGGGCCAGGTGTGCCATGGCTGCGAACAGCAGCCTTCTCGG
TAGTATGTGCACCGTGTTGCTTGTATGTTGTATGCGTTGCCCTAAGGACCTTGGAGACAG
ACCTTTCCAATGGACGTTCATGTCCCTGACCTGATACTGTCTCCAGTCTGTGCTCTAGAT
AGGTACGCAGGGTGCCTTTGAAAGCCCCAGGGCGTGGGAGGAAAGGTCCACATTGGCCAA
GTCATTATGTTCATCTGCACCAAGCTGCAGAACAAGGAGTATGTGATTAAGACCCCACAC
AGGACCAAGTTCAAGTTCCCTAGCTGCTAGAAGATCCATATTTCAAAGAAGTGAGATTTT
ACCAAGATTAATGTGGATGAATTTGAAGACATGGTAGCTGTGAAACAGCTCATCCTAGAC
AGCTATCAGGTCGAACACCCCCAATCATGGCCCCCTGGACAAGTGGTGGGCCCTGTACTT
ATGGGGGCTCCCACTGTTTTGCCCCTCCTTATTCACACCCACCAATAAAGCCTACTTCCT
AACCCCCAAAATAAAGAAATAATAATATTATTTATCTTTATATCATCTTTTAGTGTCTTT
TTTTGTGCACGTATTGCAATGCTTGTAATACATTGGTAAGTATACATTATGGAAGTATGG
GCTGAACATTTTTTGCTGATTAGAGGGTCACAATCAAAAAGCTGGTGACCACTGATTTGT
ACTGAGACTGACATGTCCAGAAGTCCATCCAACTTATGAAGAAGACATGTGGATGGTGGC
ACAGCTTGGACTCTGTAATTCAAGACTGTAAAACATTTCTCACTCTACGTTTTATGACCT
ATAACACATGATTACATGAACTAGGGAAAGGATTGTGCTTTAGAAAGTCAGGTAAGTGTA
TTTGCATTTCCATTATCAGGAAAAACTCCCTCCATCCTCATTCCTCAACTTCTAGGTTTT
TCCTAGGACTAGATTTAGGGACTAGATTTAACAATCTTTCAATCAAGTTTGTTTTCTTTG
TTACTTTCACCTGGTTCAACATCTAAGTAAATCAACATTGCTAATCTGTTAGTTTTTTGT
TTTTTTTTTTTTTTTGAGATGAAGTCTCGCTATATCGCCAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved