Pan_troglodytes Locus Mono:138:SNORA70
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:138:SNORA70
Pan_troglodytes
Mono:138:SNORA70
4
SNORA70
1001..1133
2133
TAATGCTGACTAGATCCTATAACTACATTCTGCTTTTTATAACTAAAGAACTCCAGAAA
AATAAATGTAATAGCTTTGCTGGAAAAGATTAACTTTACAATGCCTTCCTAATGACCTTA
CTTTTTTTTTTTTGAAAAGTATTTTCTGGTATACAAAAATAATATTCTGAAATATCTCTG
TGATATTTGATTGCCGGATTTAACCTACATACCTCTGAACCTTGGTTTTTCAGACATACA
AACTGCTTAACAAGTTCCAATGCAATAATCAATACACCATTGCATAACTTAGAGTAAGAA
AAGTTGGTAGATATTTCAGCAATGCCCTAAAATATGCTTCTATTTAACACTTTGAGACAA
CCAATACACTATTTATAGTGTTGAGACAAAACAAACCTAAGATCACAGAAAAATATTTAT
TTTAATAAAATGGTATTTAAGTAGATAGTTTTTTTGTTGTGGTTTTTTTTTTTTTTTTTT
TTGAGATGGAGTCTCCCTCTGTCGCCCAGGTTGGAGTTCAGTGGCCCAGTCTTGGCTCAC
CGTAACCTCCCCTTCCCGAGTTCAAGCAGTTCTCCCTGCTTCAGCTTCCTGAGTAGCTGA
AATTACAGGCATGCACCACCACGCCTGTTTAATTTTTGTGTTTTTAGTAAAGATGGGATG
TCATTATGTTGGCCAGGCTGGTTTTGAACTCCTGACCTCAGGTGATCTGCCCACCTTGGC
CTCCCAAAGTGTAAGTAGATAGTTTAAATGATTATGGGTTTCATAGGTTTTATTAATTTG
TTTTAGTTAACATACAAGAGCACTACAAAACCACATTATTTTATTTTAATTTTTATCAAT
AAACTTTATTATATTAAAGGCCATATTGCCCACTGAATATGATTTTGATATGCACAACTT
CTATAATTTACAACTTACTGTATATGGTCTAATATAAATTACATTTAGCTATCTTGAATA
AAAGATACTAATCCCCAAAAACTTAATATATAAAATAATTTCTACAATCAATTAAGCCAC
GCAGCTCTTTTTCTCATGGGGCCTGGTGTGCAAGGGCTGCAAACAGCAGCATCCTAGGTA
GTGTACAGCAGCCTGTTCCTTGTGTACAACAGCCATTGGACATTTATGTCTTGGATCTAG
TGCTTTCCCTAGTCTAGGTTTAAGACCGGATGTAGTATGCCTTTGGAAAGCCTCAGGACC
CAGAGGTCAGAGTTTACATTGGCCATGTTCATCCATACCAAGCTGCAAAACCTGGAGCAT
GTGACTGAGGCCTTATTTAGGGCCAAGTTCAAGTTCAGTGAATGCCCAAAAAGCCACATC
TCAAACAAGTGCGATTTTACTAAGTTAAATGCATATACATTTTAAGACTTGTTGGCTGAG
AAACAACTCATCCTGGATGGCTGTGGGGCTAGATATAGCCCTGGAATCATGGGCCCCTGG
ACAAGCAGCTAGCCCTGCATTAGAAAAGAGCTGCCCCCTCTTTACTCAGCCCACCAATGA
ATTCTATTTCCTGTACATCTAATAAATCAATCAATCAATCTATCTATCTATTTAAATAAT
TCAACAATATGCAGTAGATTAAAAAACACAACTTTATCTTGATGTCTAACTACTGTGGAA
ATATTTTGTCAGTTATTAACATTCCCCTTTCAGGTTAATATCAAGTCAACAAAAATTTGG
AGTTCTCTTGACCCTTTCCCCAATGTGTAAATTAGTAATATAATGTCAATATTCAGACAG
GCAAATAAACTAAGCTCCCTTTGATGAAAACGACATGCAGTAACGCTTCCCTACTGAGAA
TCATCTTAGTTTGTGAAATCATAATCTGGAATGGCTATATCTGCAAAATATATTAAAAGA
AAGAAAATATCAAAAACATAATCTACAATACTTTTATGTATATCTAATCATTTTATATTT
CTTTTTTATTATACTACTTGAAATACATACATAAAGGATAAAGAGTTTCAACAAATCTCA
AAAAGGAAACCTAATTATGTATAATATTCTGACCGATTTTGCTTGCTCACCAAATTGAAA
TTGAAAAGAAAAAATGCAGCACTCTGTAAAAAAATAAAATGATTTCAAAATATAATTATT
GTCTCCCTTTGAGAATATAAATGTTTAAATAATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved