Pan_troglodytes Locus Mono:278:SNORA13
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:278:SNORA13
Pan_troglodytes
Mono:278:SNORA13
5
SNORA13
1001..1133
2133
AATGAATGACTCTACTCTTCCTCAGCTGGACTCATGAATTCTGTCGGGTCCCAAAACAC
GTGGTCTAAAGTCTTTTGGGCTCCTGCCGCTGCCAGCACTGACGATATGCTCTTGACCCT
GGTCGGGTGGGGGGATGTCTGGATACCTCCTCTGTGGAAAGAACTGGCCACACATCCGCA
GAGGTGACTCGGGCTGAGAACCCAGGCTCCTCCTCCCTTTGGTGACACGCCCCTCGGTCC
CTCACTGGCACTTCTCCCTCCGGCCACACGGCGGCGTCTCGCCGTAGCGCAGCGGCCGAT
GGTACAGCCCGCTCCCCCCTCGCGCTCTCGGACAGTGGGTCCTTCCACTTGTAGAAAAGC
ATTGTGGGACGGAAACCTGTCCTTTCTTCCCTTTGGTGCGAGCTTGGTGTGGTTTTTGCT
CTGGGTCCTCAGGTATGGCGCCTGGCTGTGGCCGCGTGGTCTCTCACGCAGGGGCGCCGG
GCGGGGGAACGCGGCCACCCTGAGTCTGGTGAGTCGACTGCAGCGGCCTGTGTCCGAAGT
GTCCGGGGCCGTGAACAAGGGCAGCGGCCTGGCCTCAGGCCTGCGTCCCCACGTTTGGAA
ACGGGGAGCTTCGTGGATTTGTGTTTACATCGTCGACTATGCCAGGGAGTTCTCCAGATA
AGCCTGGTTTTATTTTCGTCAGTGAAAAGGCCTTACCGTATAACTGACTTTATGCTTGCC
CTGCCCCCGTGTAAAATAACTTAAAAGCAGCGTGCCTGGTTACAGCTGTTTCCACGTGCG
GTGCTCGTCGGGAGTGATCACCTACCCTACAGGTGAGTTTTCACGTTCGTGCCAGACCAG
TCGCCATTTAAAACGCATCGCATTTCACTTTTCATTATTAAGTCGGATTTTAAATCGTGA
GAAAATTTCTCTGAAATGTATTGTCCGTTTTTAGGCTGTAATCGGGATTACTGTCAGCCA
GTCAGCAACCTTATGCCATAAAGCCGACCTCACGCAGTGTCAGCCTTTGTGTTGCCCATT
CACTTTGGAAACTAGTGAATGTGGTGTCAAAAAAGGCGTAAATTAAACGCTTTGCAGCCT
TTTCCTGCCCTTGAATTTGATATCTTTGGTGTAGGAGCTGCGTAAGTAACAGTTGCTGCT
TTTACGTTTTACACGCGTGATCTTGACCCTGCCAGCCTTAAGTGTATGGTTTCTCTTAGC
CAGTTCTAATTTTTGTTCAGGTGGAAGATGGATGCCTGAAGTGTAGACTGCTGCTAGCTG
AATACCATCTGGGAGCATAAAGATGACCTGAAGGTACGGTGATGTCTTAAAGCACTTTGT
AATGGGAATTTTTATCACCTTTTAAACTGGGGTTCCTTCTCTAGTGAGTTTTAATGTTAG
TGGTACATTCGTAGTGTTGCTCTGTCTGTAGCTATTAAGGTGAGTTAATAAATGGGACAG
CCTCCACAGCTTATTTTTGGGAAGGTTTTGCTGATACTTCCTGAGAAGCCCAGGGAAATA
AATACGCATAGTACTGGCATTCTGCATCTCTTTAAGATTTGTTTTTATGTGTAGTAATTG
AGTTTTTTTAAAGCTTGTGAAATCGCAGGCATATTACCAAATTCTTGATTAAAATGTAAT
ACAAAAATATTTGCTGTCGAATTGAGTACTTTATTTTTTCTCTTAGGATGTCCTTGGTGA
GGATTTTGAAAATTTGATCTTCACAAGAGTTGCTTGGATCATTTGAAATTTCTGGGAGTC
TGAGGAGTACTGACATAATTGCCTGCTGGAGTCTGTAAATACACATTTAAGACAGTGAGG
ATGTGAATAAATATATTAATGCACTTTGGCATTTGTGTTTTAAGTGATTAACTGCCAGAA
ATAGCTATTTCTAAAAAGTTATAAGGGAGGAGGGGTTCTTTTTTGATCAGTATTCACTGC
TGTCACCATAATTAATAGCCTTAAAATAGCTTGTGTTTGGCCCAAAGAGAAATGTACTTT
CTTCCAGTGACTCAAAAATCGTGGCTAGAACTAGACTGATTTCTAGTGACAGGTGTGCTT
TACTGCACTCAATGCGTATTTTTCCTCCAACTAAATTGTACATTTAATGTTGCCATATCT
TCTGCCTTTGCTTTGCAGGAAATGACAAATAATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved