Pan_troglodytes Locus Mono:196:SNORA72
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:196:SNORA72
Pan_troglodytes
Mono:196:SNORA72
3
SNORA72
1001..1129
2129
AAGATGGTGAAACCCCATCTCTACTAAAAATACAAAAACAAAATTAGCCAGGCGTGGTG
GCGGGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGAATGGGGTGAACTTGG
GAGGCGCTCTGCACTCCAGCCTGGGTGACAGAGCAAGACTCAGTCTCAAAAAAAATAATA
ATTCTCCCAGCCTGGCCAACATGGTGAAACCCCATCTCTACCAAAAGATACAAAAATGAG
CTGGGTGTGGTGGCACGTGCCTATAGTCCCAAGTGCTCGGGAGGCTGAGGTGGGAGAATC
ACTTGAACCCAGAAGGCGTAGGCTGCAGTGAGCCAAATCAAGATTGCACCACTGCACTCC
AGCCTGGGCAACAGAGTGAGACCCTATCTCAAAAATTTTAAAGAAAGAATTCTCAAAACT
CAGAAGGAAACAACCCAATTTAAAAGTGGGCAAAAAACATGAACAGTTATTTCAACAAAA
AAGATATACAGATGTCAAATGAAGACAATATGTTCAACATCATTAGTCATTACGAAAATG
AAAACTGAAACCACAATGAAAGATTCTATTTTTCCAATATTTCTCAAATCTATACTCTTA
TCAACACTGATACTATCCTAAAAAGTTCAGATCTTCAAAATCTCTCCCAACTGCTGAAAT
AGCCTCCAAATTGTTATCATTGATTCCCCAATTTCCCCTCTTGAATTCCTCCTTCAAAGT
GAACCATGTTATCTTTCTGAAATGCAAGTCAGATATTATTGATCTCTCATCTCATAAAAA
AATTATTCTATATCTTAGATAATATAGCATACCACTCAAAGGCCTTCTCTAGATTGGTAT
AGGCCATCTCATCTCAACTGTCACTGTATCCATATGCCTACTACACCCTTGCTATTGATA
ATACAGAATGATCACTTGTATTGTTTACTCAGTCTCAAAGAGACTTCTCATCTATATCCT
CTACTTGTACCAATCATATTCATACTTTAAAATTCACTTCATTATGAATATACTCACCGT
TTTGATTTTATAATAGTAACGACATGCTAAACATTCACTATATTAAGACCACGCATGTGT
CTCGGACCTACCTTTCCCTAGGTCTGTTTTTATAAATGCTGGTGATAAACCAGCTCTGAC
TTATATCATTTTGTATGACCATCTAAGGGCTGTGATTCTAGGTTACCTTTAGTCACCTTT
AAGGAAAATGATAGTACAGCTAATCTAATAACTTTTGCAAATAATCAGTGCTAATTTGGA
AACTTCTGTCAAAAAAAGGCATTACCAAAGGAAGGAAATTTCATGTGTACCAGCTGCTAT
TAAATAAACTGTAAAATTACTGTATTTTTCTAGAAAAAAAAAGTTCACTTCAATCACTAC
CTTCTGTATGAAGCTTTTTCTGATGCACAACACACAGAAAATTCCAGCCCAATACCTTCC
CTAAACTAAACGAGTAGTAAAACTCTCACTTTACAAATCCAATACCTTAACTCCTTTATT
ATGCTGATACCTTCCATTTGGTAATTATAATTGTGTATGTTTTATCTCCTCTTCTAGTAT
AAAGTTCTTTAAAAAAAAAAAATCTTTAACACTTAGCACAGTACTTTATATTAATTAGGC
ATCCAAGTAGTATGTGGAATAAAGAAGACTCTGGATATTCATTTAATTTTGAGGATAAGC
TATAATTAAGTTATTCCAAATCCTATCCCCCCAAAAAGGAAAATATCAGTCCTAAAACAA
AGTTCTTTAATAAGAATATTATCATGGGCTGGGTGCAGTGGCTCAGGCCTGTAATTACAA
CACTTTGGGAGGCTGAGGCAGGAGAATCGCTTGAGCACAGGAGTTTGAGACCAGCCTGGG
CAACATAGCAAGACCCCGTCTGTATTAAAAAAAATTTTTTTTAAAGAGAGAATACTATCA
TGAATTTAGGCCACAATCTTTTAAACAAACCTTTGATGAGTTTACACTAAGCAAAGTGGT
ATGAAACTTTCTCCAGTCTAATAATTTTGTGAGCTTTTTCAAAAGGAGTTTTAGTGAATT
TAATTGATATGCAAATTAGAATTCTGAAACTTCAATGAATTTTACCATGGCTTGAAAGAA
TTTACATTTCTAAGCAATAAATGCTACTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved