Pan_troglodytes Locus Mono:229:SNORA57
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:229:SNORA57
Pan_troglodytes
Mono:229:SNORA57
11
SNORA57
1001..1149
2149
CCTGCCTCAGCCTCCCGTGCAGCTGGGACTACAGGTGCCGGCCACAACGCCTGGCTAAT
TTTTGTGTTTTTAGCAAAAACGGGGTTTCACCATGTTGGTCAGGCTGGTCTCGAACTCCC
GACTTCAGGTGATCCGCCCGCCTCAGCCCCCCAAAGTGCTGGGATTACAGGTGTGAGCCA
CCACCCCCGGCTTTCCTGAGATTCTTAACAGAATCCAAAACCCAAAGAAAGGTTGTCTGC
TACAGGTATTGTGAGAGGCTATCAGAGCTTAGGAACTAACAGCCGACAGACATTCCCCGC
ATAAGCGTCAGTGCACAAGGTGAGCTGAGAGGTGAAGCTGCTCCGGAGCTCTGCAGGGAG
GAAGGAAGACTCGGTAGAGACGACCAACAGGAAGAGGGTCTAGTACTTACGACCGCTTCT
TGAGGTGGTGCCGCGTGATCAGCCCTTGGTCTATCACAGCCCCGACCACCCGGTGCCTCA
GACGCCGCTCCCGATTCAACACCCGCCGGCGTTTGAACAGCTTCTTCTTCAGCTCCTGCC
GGGGAGAAAGATGCGAATCAGATGGAGTGGGCTCGCCGCGACCCGGGGCCCCTCCACCAG
GCAGCCCCGGCCCCCCACTGATCCCATCTCGTGCGAGATAAAAGGGCTCAGGGACGCTTG
AGGAAACAAAGTCGCGGCCCCCACACAGTCACCGTTCGGGGCCGGTTGATCTTTCCCCCC
GGAGCTCCCATAGTCGCGATTCCACGCCAGTTCACGGTCCGTACTTCCGCTCAGCGCCGG
ATCCGCGGGGCTCCGCCCCGGCCTTCCGCGGGCCAATCGCAACCCGGGGGCGGGTCCTCG
GTTTATATAAAGGAGCTCCGCGGTGCGGGAAGTCTTTTGGAGGGCGATGAGCTAGTAAGT
GCGGTTTTAGCTGTAGTAGCCAGATTGGGCGGCCGGGAGTGGTGGGGGTGCCGGGAGGAG
TGGAGGTGCCGGGTGGAAGGCTCTAGGCGGGGTCTCAGGACCCTCCTTTTCTTGGCGGGG
ATCGGGCTTGTGGTACCGCTCCCCGTAATGTACGGAGGAAGAGGGAAAGGGCTCTGGCCC
CCTCGGCGTCATGTCTTCGGTGCTGGCGGCTTCCCATCCGCTGGTTCTATCCTCAAGCGC
CGGGACACCGGGAATCTCGGAGAAGGACAACCGAGATCCAGCTGGCTCCTCCATCGGGGT
GCTCACACTTTCTCATTTGATTTCAGGTCTGCGGACGCTGTATACCCTCCTCCACTTCCC
GCTGCAGCCAATAAAGGCCGTTCCTACCATAGTCTGTCCGCGTTCTTTTTTCCGAGACTG
CAGAGTTCGGGGAAGCTGTACGCCGCCTTTCGCTACGCGGAATTTGCAGATCTTCCCCTG
GACCTCAGGCCTCTCCGGCTGGAGTAGGGTGGACGCTTCACATAAGGTTCTCTGGTCGAA
CTTACCCGAATCTCCAGATGGCCGCGCTGCGTCGAATGCTCCACTTGCCGAGCCTGATGA
TGGGGACGTGCCGCCCCTTTGCGGGTAGGGAGGTGGGGGCAGAGTGGGGAGGGCAAGGTG
GGGGCAGATTGGGGAGGGTAAGGTGGGTTCCTCGTGACTCAGGAGTGTAGTCCCTGAAAT
TGTGATTTTCAAACCCTACGGTGGGCCGTGCGTGGTGGCTCACGGCTGTAATGCTAACAC
TTTGCCAGGCCGAGGCGGGCAGATCGCTTGGCCCAGGAGTTCGAGACCAACCTAGGGCAA
CATAGCGAGACCCTGTCTACAAAAAAAATTAACCGGGCACGATGGCGCCTATAGTCCTAG
CTACTCAGGAGGCTGAGGTGGAGGCTTCAGTGAGCCATGATTGTGCTACTGTACTCAACC
CTGGGTCACAGAGTGAGACCCTGTCTCAAAAAAAAAAAAAAAAAAAAAAGACGCCAGTGT
GTATATACGACGTTTTTGCAGTGGCGACATAGACCAAGTGACACCCTCCAACCGTGCCCA
CAGGCTCACTGGCTGATAGTTGCCTGGCAGACCGCTGTCTCTGGGATCGGCTGCATGCCC
AGCCTCGTTTGGGCACTGTCCCCACCTTCGACTGGTTCTTTGGATACGAGGAAGTCCAGG
GGCTCCTACTGCCATTGCTGCAGGAGGCACAGGCTGCCAGTCCTCTGCGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved