Pan_troglodytes Locus Mono:180:SNORA43
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:180:SNORA43
Pan_troglodytes
Mono:180:SNORA43
3
SNORA43
1001..1130
2130
CTACTTTTTAAATGATTAGTAAGATGCAATGAAATAGTTTTGCTAGAAAAAAAGTCAAA
ACGAAACCATTGTAATAACAACATAGTAATTTCTCAATGACACATGAACACATTATTCTT
GTAAATACAAGCGAAATATTACAGTTAAACTCAAGTTCCCTTTGACCACCATCTCCCCAG
AGGTCAATGTTGGACAGAAAATTCTCTAGAATTCCATATTGACTGAAAAATAGTGAATAT
GAATCACTTCTCCCTTTGTTTGACTTTATTGCACACCTAATATGTAGCAGGTGCCTGAAT
GTAGCCCCGAGGTAAAACTGAGGCTCTGAGAAGCTAAATGACTTGTCCCGGGTTGCAAAG
GCAGGAAGTGGAAGAACTGGGTTTTGAACTTAGTTTCCCTGACTCTCCACTCTGCCTGCT
CACTTCTTGTTTTACTAGGCTACTGTCTCCTGTTCTGTTGGTAATTTTATGGGAAACAGA
AAACCAGTATCCAATCCACGGTGCCTAAAAAGTTACTAAACATTCTTCCTTAAGGGAAAG
AATCATCCAAAAGTTAAAATATTCTGCGATGCTGTTTAACGCTGAACAATACACCCGGCG
CTAGCTCACAGGCATTCTTAGAGAGACACTATTCTACTGGTAACATAACAAAGAGCCTGT
CAGTAATTTTATTTTTTTAATCCAAAATTTTATTTGATAAAGAAAATGCAGTCAAAATGC
ATATTTATTCTCAATAAGGATATCCATTAGAATAAACACTTACGTCATCTTCTTTTGGAG
TGTTTATTTTCACTTGATATTCTAGATTAACATTCCTTTGCTCTTGATCAGGATTTGGTT
TCCATTGTAAAAGAACTTGAGCCAAACCAGTAACTTTAATGGTGAAATTGACAGGTGGGA
GAAGTGAAACTGTTGATTCAAAGAATAAAGAAACAACACAATGTTCAACTGGACGTAGGC
AGCACTTTTAAAACTTTTCGAATATTTATTGCCCTGCAGATGCTGTCCTGGACCTGCCAG
CACCACAGACACAGTTGCTCCTGCGTGCCTGTAACACCGGGGCAAAGAGAAAGTGGCTAT
TTCTACCCGAGTAGCTGGGACTACAGGCGCATGCCACCATGCTGGGCTAATGTGGGTTTT
TTGGTATTTTTAATAGAGACAGGGTTTCACCATGTTGGCTAGGCTGGTCTTGAACTCCTA
ACTTCAAATGATCTGCCCGCCTCAGCCTCCCAAAGTGCTAGGATTACAGGCATGAGCCAC
CACACCTGTCCTAGAAGAGGTTTCTTCAAAACTGTTTTTAATATCTTTTTTACGTTGCCC
ATGTCCAGGTGTTTACCTATAATACCTATATTTTTACTGAAATATGAACATGTTACTATA
TCACTATTCACTATAACCATAATTTTCAAACTGAGAGTCATTATCCATTAACAGGCAATA
ATAACAATGTATTGGTTTGTGACCAGAATTTTTGTTTTAGTAATGTGGAAGAAAAATAGA
ATAGAAAATATCAGTGTGCATCAAACATAATAAGAGCTGTTTCATGAATCTCGTTTCCAC
TACATAAAGGTAGTTATATATTTGTATGTGTGCTGGTACATAATGTAAAAATGTATTTAC
CTCTTATTATGAGTCACAGACAAAAATATTTGCAAGCAAACTTACTTAAATAGGGCTTTA
CAGAAAGAAAAGGTTTCTTCCCCCTTCATGAGCCATTCTCTGACTTTGCTTTCAAAATTA
AAGCTTTTGTTTAATTACAAAATCAATATCTGTTTATTGAAGAAATTTTGGAAAACACAG
ATAAGCAAAAAGAAGAAAATAAATTTTTTAAAATAATTGTACCACTAAGAATGGAGTTAA
CATATGATATATTCGTTCTGTTTTTTCTGGGTGTATATTTATGCAATTTTTAATTTTTTT
TTACCACAATTAGGACGGTATTGTGCACACAACTACAAAACCTTCTTTTATTCATTTACT
AAGTTATCAGGATTTATCCATTGACCTTGACAGACTTCCACACCTCTACATCCATGTTTA
CCACATGAGGATTTTTAGAGCTCTGTCTATATTGCATTGTCCATTACGGTAGCCACTGGC
AACTTGTGGCTATTGAAATCGTATTTAATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved