Pan_troglodytes Locus Mono:172:SNORD66
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:172:SNORD66
Pan_troglodytes
Mono:172:SNORD66
2a
SNORD66
1001..1081
2081
GGTTCTTTAATGTTGTTTGTTTTCTCCTCTCTCATCTCCTTTCGTTACTCTTATTGGAT
ACAGATTAGACCATTTGATGTCCCACAGCTCTTTGATGTTCTGTTAAATTGTCTTTCAGT
CTTTTCACCCTACGTGTTTTATTTTAGATTATTTTTTGTTTCTCTGGCTTCAAGTTTCCT
AATTTTTTTCTTCTATAATGTCTAATCTGCTGCTAATCTCTTCCTTGGTATTTTTCATTA
CAGACATTGGTTTTTGTCATCTCTAGAAGTACGGTTGGGTCATTTTCCTTGTCTCTCCTT
CATGTGCTCATGCTTTCCTCTATTTCTTGATCATATAAGATATTTATAATAATTGTTTTT
ATACCCTTGTCTACTAATTCTACCCTCTTTGACATTTCTTGGTCTGTTTCAATTGACTGA
TCTTTTTTCCTCCACATTTTGCATAGTGTGTCTCATAATTTTTGATCAAATGCCAGATAT
TGTGAATTTCACTCTGCTGGGTGCTGGATATTCTTATATTCCTTCAAATATTACTGAGCT
TTGTTATGAGATGCAGCTAAGTTATGTAAAAACAGTTGGATCCTTTTGAGACTTCTTCTT
GACTTTGTTAACTGGGACAAGCAGCTATTACAATAGGGCTAACTTTACCATACTATTGAG
GCAATTAGTCTAGGGCTTGTTTTTCCCTTCAGAGGACTCTACCCAATGCCCCCTGAGTTA
TGATGTTTTTCACTCTGCCTGGTATAACCATGGACTATTCCTAGCCTTCTGTGAGCTCTG
CTGACTACATTCCATTGAGAGTTAATTCTCTAGCTTTGAGTAGTTACTTGCATGCTGTGA
TCAGTATTTAGCTGATGACAAGGTGAATCTTTTACAGAATCTAGAACTTTCTCTTTGTGC
AACTCTTTCCCCTGTGCCACTGTGTGTGGGAACTCTAGGTGCCTTAGACTTCCCAATCTC
CCAACTCTATTCAATTCAGAGAGACCTCCAGGTCTTGCCTGAGTTCCTGCATACTGCACT
GTGGCCTGAAAACTCTCTCAAGAAAGTGAGTTGCTCCATGATGGAACTGAGGATCTGAGG
AAGGGAGGGAAAAAAAATAAAAATAAAGTAAGCTGGGGTAATCATAGGGCTCACTTTATT
TGCTTTGCCTTTCTTAGGGATCACTGTCCTGCCCCACTTGATGTCATGTCTGAACCCCAT
TGTTTCATATATTTTGTCTAGTTTTTCTGTTTGTTGTTTCATACAGGAAGGTAAATCTGG
TTCCTGATACTATCTTTCCAGATACAGTATCAGAAACTAATAGAAGTCCACCAAAAGTGC
AATTCATCTCAGTGGAGGAAAAGATAAATTATTCAATAAATGGTGTCAAGACACATATTA
AAAGTTCTAATTTGCAATTACAGGATAAAATCTGAGACAGTTTTAACAGAAAAGAAGTAT
ATTAAACATTATTAATAGATTACAAATTTTCCAGATGGGCCAGAGAGTTAGGCTTTGAGG
TGAAGCATTTGGAAACTGAATTAGCCTGTCCAACTATTCAAAGGAATGACTGCAGCATTC
TGGTGCTGGCAACATACTTCACACCATAGTTGTGCTGTTGCTGTTGCTGTTGCTGTTGCT
GTTGCTAACTTCTCCATGTTTTTCTGCTGTGCTTCATCACCCTCTTCAGGAACTATGTTT
TGTAGTACCTGCCTTCTCATGATGTTTTTTCCCAAATCAAGAATTCGTGAATGCATACCT
AGTTGATGAAACCTAGGTCATGCACCTTCTTCAGAGCCACAAGAGAAGCTGGGGAATTGA
CTTTGTATCTGCCTTACTTTGATGAGACAGAATACAATTTTAGAACATCCACAAGTATAG
AAATATGATTCAAATGACACTGGGTGGCTACAAATAGGACAAATAGTCCCACAACACAAA
CTGAGTAGTCATGTGAAAACAGGTGAAGTTGAATCCCTACCTCACACCTTATACCAGAAG
GTCAGAGAAACCAGGAAAAAAAAAGAAACCATAAAGGTACCCAAAGAAAATTAAGAATTT
TTAAATAACTCATTTTATTTTTCATATTGCTGCCTTCTAATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved