Pan_troglodytes Locus Mono:173:SNORD89
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:173:SNORD89
Pan_troglodytes
Mono:173:SNORD89
2a
SNORD89
1001..1114
2114
GACAGACCAAGGTAAATTGTTTTTGATAATTACAGAAGTGTGATTTCTTAATCAGCAGC
TGTCAAACATAGTGTTCCTTAATTTAAAAGCTTGAACACTAAATTATAAATTGGAGAGGT
TGGAATAATTACGGTCATATCTCTAGAAACAAAAGTCTTTAGTAGCAAAAAAGAAATTAG
CAAGAGAAGAAAACTGTTCAGTACTTTGAAAGGAAAAAGTTTTCAGTGACAGAAGTTTTT
TTAGATGAAAATTAACATGATAAAGAAGTGACAGGCCAGGTGTGGTGGTTGACGCTTTTA
ACACCAACAATTTGGGAGGCCAAGATGGGAGGATCTCTTGAGCCCAGGAATTCAAGACTA
GCCTAGGCAACAAGGCAAGACTCATCTCTACTAAAAATTTAAAAAATTAGCCAGGTGTGG
TGGCATCTGCCTGTAGTCCCAGCTGCTTGGGAAGCTGAGGTGGGAGGATCGCTTGAGCCC
AAGAGGTTGAGGCTGCAGTGAGCTGTGATCACACCACTGTACTCCAGCCTGGGCAAGAGT
GAGACCCCGTCAAAAAAAAAAAAAAAAAAAAAAAGAAACAAATATTACAAGAGTTTTTGC
TGAAAGTTTTAAGTTGATAAGATGCAGAGAATTGGGGGAATGTATAATAAATCAGGTTTC
ATTGTTATATTATTTACCACATGAATCACCTTCCTCCTAACCATTATAGGAGCCATGTGT
TCACATGTCATGTGGACCAGTATTTAACTGTGGAAACCGCGGGTGGCATGGAGAAGGAGG
CAGTGTCCGTGACTGTGCTGCTCTCCGCAGCCCCCTGCCTGCTGTCCTGCTTCCTCGGCT
CCTCGGTGTCTGGACTGGCGTTCTGGGTTTCCCAGCAGAAAACTAAAGGGCCAGAGAGGT
GTAAAAACACACACCACTTGGCAGGTAATAATTTCCCCGCATGCTATCTTTTTAGGGATC
CTGAACACACAGCCTTTCCCAAAAGACTGCTCCCTCCAGCTACTGAGGAATGATGACAAG
AAAAGGCCGAATTGCAGTGTCTCCATCAGCAGTTTGCTCTCCATGGGCACACGATGACAA
AATATCCTGAAGCGAACCACTAGTCTGACCTCAGTAGCAGGATTGGACGCTTCATGCCAT
GGGAGCTGTCAAGAAAGGCATCCCAAAGAGAACTGAAATTTAAAAATAATAATAGACCTT
CAGGAATAGGTGATTGTCCCCATATACTGGGGATGAAATACGCAATGTAACCAAATTCCC
CAGTAAGGTCACTTAGTTTGGCAATAGTCTTTTCTTTTGAGCATGTTGAAGTTTATTTGC
TCAATGAAGGCTGAAATTATAAGTCAGTATATAGGTATTACTAAGTAGAACTTGAGGTAA
TTATATGTTTTAGTCAAAAGCAGTTTCTGTGGGCTTGGTATAAACCCTACTTTGTGATTT
GCTAAAGCACAGGATGTTGACTCAAACCAAAACTAGTTTTGTAGTTAATATGTGTTGTGT
TTCTGTGACTTAATAGTCAACTAGAAACGCCACCTACAACAACCCAGCTACTTAAGTTTT
AAAAGTTTTTTTTAAAACACTTGTCACCATATTTTGAAAAATACTAACATTTGGATTACT
AGTTATAAAAGTGTAATTTCTACTGTGTCATAATCAGCCATGCAGCTGGAGACTTGCCCT
CTTTGTACAGCAAAGTTGTGAAAAAAAGTATTTGCACTACATTTATTTAAACATTAGGAA
AAAAAGCCAACCCATGCTTTTCTTTGCCGAGATGTAGGGCTGTATTATTGGCTAGTGAGA
AGCCTGGGAACACTAGGACTTTGTGTGGGCTGATTGCAGGTATCAGATCCGGGATTATAC
AGGTACTGTTGGAAGTATCTTGGGGATTTTCCTGATAAGAACAGTAGTGATTGCATAAAA
AGGACAGGATGTAAAGTGAAATCAGTAAAATATCTTAGTAGACAGAGGGTGCTGAAATTT
TAACAAATGTGTAAAAAGTTCTTCCTATGCATTAATTTTCCAGATACCCTTAAAATGTTT
AAGGAATGTAATTCAAAATACTGTTTAAAAGAGACATGTGACCATCATTCTCCCAGAGAA
TGTGAATCATTTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved