Pan_troglodytes Locus Mono:121:SNORA72
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:121:SNORA72
Pan_troglodytes
Mono:121:SNORA72
8
SNORA72
1089..1180
2180
GAAAGTAAAGCTCTTACTGGGCTGGTTAGCTGAGTCATTGCATGTAGAGGTAGAGTAAA
GGCAGCACAGGCGCAGTCATTGATCATGCTGTGCCACTGATTATGCCCAGCCCCAGCAAA
ACAAAAACAAGATGGATCCAGAGATGCCTGAGTTGCAGGTGAATTTGGCAAACTCTCATC
ATTGCCATACTAAAAACACAGCCCAGGGAGGAGCTTACTCTCCATTTTCCACACATGCGT
CTTAGGTAGAAGCATGATCAATGACTGTGCCTGCACTGCCTTTACTCCACCTCCATATGC
AATGACTCAGCTAATCAGCCCAGTAAAAGCCTTATTTTCACCTTTGTTCAGGGAGGCACT
GCTTTGGGGGACTACCTCTGGTTTCTTCCTTACCTGTTGCAAGTAATAAAATGTCCTTGT
TAAATCCTCCTTGGTTGTGGTCATTGGACTGTCACCCACCAAGCAATCGAACCCACCTGT
TGTGTCGATAACATTACTGACAATACCAAATGTTGGTGAGGACAATATCAAGTATTTGTG
TTGCTTTCATATGTAGCTTGTAGGAAACATTGTCCATTTCTTTTTTTTTAATAGTTTAAC
TTTTAGCTTCAGGGGAACAAGTGCAGGTTTGTTATATAGGTAAACTCACGACTCAGGGTT
TTGGTGTACAGATTATTTCACTTACCATGAGATCCAGAAGTCCCACTCTTGAGTTTTTAT
TCCGGTGAAATGAAAACTTATGTCCATGTAAATACTTTTATGTGCATTCATAGAGATAAT
TTATAATATTGCCAAGTTAGAAACAACTCAAATGTCCACTAATAGAAGAGTGAATGGAAA
ATGTAATGGAGAGCTAGTCAGCAAAAGAAAGGAATGATCTACTCATGTATTCAGGAACAT
GGATCAATCTCAAAAGCATTGTGCTAGCGAAGGAAGACAGACACAAAAGACTATATTGTG
TATGTACACAATTAATATTAAATTGTAGAAAAGACAAAACTCTGCCAATATTCTCATTGC
TCTGATTTTGTAATAGTCAGGACAGCCTAAACATTTGCTATATTTTTTTAATTTTTAATT
TTAATTTTTGTGGGTATAACATTCACTATATTAAGATCATGCATGTGCCCCCAAACCTAA
TTCTTTTCTTAAGTCTAGTTTTATAAATGCTAATGATGAACGCAGAAAAGAAAAAGGAGA
TAAAAAAGACAAAGAAAAGGCATAACTTTAGTAATAGAAACAGCTCAATGGTTTCCCAGG
GCTGCATTTGGGGGAAGACATTAATTACAAAAGGTCATGAGGAAAGCTTTTGGGGTGATA
TAAATTTTCTGTATCTCAATTTTGGTGGGTAAGTGGCTATACCAGTTTGTAAAAACATAT
GAAATATGTACACTTAAAATAAACAAATTTTATTTTATCCAAATTATACTTACAAAATGG
CCTTTTTAGATGATTGACAGTAGCAAGTACTTCTGGTTAAGCACCTGGCTGAGAGGTGAA
AGAGGTTGAACTCCTATACACTTGTTGATGAGAAAGTAAAATGGAACAAACACTTTGGGA
AACTGACCACTTCCCTCTCAAAGCTAGACACATTACTCATTAAATATTCCAGGAGTTCCA
TTCCTAAGTATTTGCCAAAAATAAATGAAAATGTACCTTTATGCAAAGGCTTGTACAGAA
ATGCTTATTGAAGCTTTATTCACAGTAGCAAAAACAAGAAAATCGTATATACAAGTATTA
ATCAAGAAGTGAACAATAAATAAAATGAGGTATATCCATATAATAGGATAACAATATAAA
TGACCATAACAGTAACAATATAAGTGAGCTATAGATATGCAAAAACATGGATGAATCTCA
AAGTCGCTATGTAGATTGAAAGATGCCATATACAAAAAGTCCACATTGTACAATTCTACT
TACAAAATTTTTTAAAATGCCAACTAATCTACAGTGAAAGAAAACTAATCAGTGGTTGCT
TGTCCATAATGTTCACTGCTGGTGGTCCAGTGCCTCCCAAAAGCCTTACACATAACAGGA
ATGACAATGATAATGACAATGATGATGATGATGATGATAGTAACTATTTGATATGTATTT
ATTGAATATATAACGTATTAAGAGACTATTAATAATGACCCTAACTCCTAAAGTGGTATT
ATGGTGGAGGCCCTTTATAAA
  Untranslated Region
  Coding Sequence
  snoRNA
NC_006475
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved