Pan_troglodytes Locus Mono:238:SNORD23
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:238:SNORD23
Pan_troglodytes
Mono:238:SNORD23
18
SNORD23
1001..1104
2104
GGAGGATTGCTTGAGGCCAGGAGCTGGAGTCCAGTCTGGGCAACAAAGGGAGACCCAGT
CTCTACAAAAAATTAAAAAATTAGCCAGGCATGGTGGCACATGCCTGTAGTCCAAGCTGC
TTGGGAGGCTGAGGTGGGAGGATCGCTTGACCCCGTGGAGAGGGGTGGTGTCAAGCAGTG
AGCTATGATCATGCTACTGCACTCCAGCCTGGGCGATAGAGTGCGACACTGTAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAGGAAGGAAGGAAGGAAAGGAGGAAGGGAGGGAAGGAGGA
AGGAAAAAAAGGGAAGGAAGGAACAAATGAACAAACCGATTTTCAGGGAGAAAAAAACTC
CCCCAAGGTCACTCAACAAGGTTGTGGCTGACCTGAAACTTTTGAATCCAGTACCAATGT
GCCTTCCTCTGGACCCCCTTACTGCTTCCTGTGGTGTTAGTGACAAAATACTTAGGATAA
ACCATTTCAAATGAAAGATCAGCTGGCAAGCTTGAGCTCCACACTCATCTTGACAGGCTA
AGATTTAAACTCAGAAAATCATACAACTAGGGGCTGCCAGTGTTGCCAAATCTTACAACC
ACTCACCTAATGATGTGGTTTTGAAATGTGATGCCAGGAAACTGACCTTTCCTGTGATAA
GCTCATAACTAATTTCTTTCAAAAACTCACTTGTGGTGAGCATGCTCTCTGCCAGAGCTC
GGGACTGGTGCTGACCTGCAGGATGGAGGGGAGAAGAGAAGACTCATCAACAGAACAAAT
GTTGCTGGAACATTACTTATAATGGCAACAATTGGAAACAATCAAAAGATGTCACTATAG
GGACTTGGGTTAAGAAAATTATGACACATCAAAAGGTATGGACAATTATACAGCATTTGA
AATATCAATTCTGACTCTAGACAGAAACAGAAATGTTTATAATACAGATGATCAGGGGAA
CAAAATGATGTACCTTATGTAACTGAAAATATGCACGTTTGTGTTTAATGACTAAGGAAG
GTCCCTGTCCCCCCCAGGGGCTGTGAGCAACACCATGGCTGCCCCAGGGCTGGCCAATTG
GGCAGATGCCCAGGGGCTGAGAACATGGGGGAAAAACAGACTAGGGAAGAGTATGAAAAA
CCTTATAAAAATTGTGCTTGCATGGTTATAATGAATTTGCTTTAAAAATATAAACATGTT
TTTTACAAATAAAAATGAAAAAATATTAATGTATCACACTGATGAAGCTTTCTGGAAATA
CATGTAGCACAGAAAAATGGGCAGACAGGTTTTGTCAAAGTGAGGGGGTTTTCTTAGCTT
CTTTGCTAGAAGAGGTGAGAGCCATTCAGTACAGAGAAGAGAGAAGCAAAATGTAGTCCA
AATGGCTACCCAGGAGGGTGCCTGATAGAAAATCTGCACAGTGCAAAACAAACAAACAAA
AATCCCCTCCCACCCCCCAATTTTGTAGTGTACCAACTTTCTGAATCTTTAGAGACTATG
TTACAATATTAAATAGACTGTTCAGTGAGAAGGGGAATATATGAGCTACTTTTCTGGCAA
ATTCGATTAACTGGCTTAGGCCACCTGTGGCACTGGCTCTATCACATGCTAGAGTAGTAA
CATTTCCAAAATCTTTAAAGGACAGCAGTTACATGAGACAGGGGTATCTGTTACTAGGGA
GAGCTTTGAAATAATGCTCCCACAACCAGCTGACAGGGGCACCAGCCAAACTGAGGGCTA
CACAAAACCTGATCTGAGAAGGAAAGGGAAAGTTAAAATTAGGAGGATGAGCCCAAGCTC
CAGCAATTAATCAGAGGTTGATTATGTGGATGCCTGAAACACATAACACACATTTTTAAA
TGGAAAAATGGTTGAATGAATTGATTAAACAAACAAAAAACAAAAAAATTACTCACCTAA
CACTACCACACAAAATTCATTTCCTCTGATTTTCGATGCACAAATTGCCACCACATAATC
TGGCAGCCTTTGATAGTGTCTCATTTCACTGAGAGTCCTTAAGGTCTCTGAAATGCCCTC
CGCCAAAGAGTTCTGGGTCACAATCACATGAACCAAGTCTTGAGATACGCTGGCAATTAA
TCTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved