Pan_troglodytes Locus Poly:20:SNORD116
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Poly:20:SNORD116
Pan_troglodytes
Poly:20:SNORD116
15
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1001..1092, 2143..2231, 3273..3364, 4401..4492, 6264..6355, 8516..8607, 12120..12211, 13955..14050, 16029..16120, 19090..19180, 20962..21044, 22731..22817
23817
GAGGTGTCTGATAATGAGTGTGTGGGTTTCTGTATCCTGGTGACTTCTACTCAGAAATG
TGACCCAGCAAGGTCTCTGTGCTTAAATACCTTAGTGGCTTGTGATGTTAGGTTATTTTC
AAATTCCTCCTAATTGTGTGTGACAATTCACACAAGTCTTTGTGAAGTTGTCCTTGAATT
GTATGACAGGGCTAGTGTCTGTAGGCCAGTGATGGATACGTTTTGGACTCCACAGCCATG
TTCACAGCCAAGTGCCTTAAGATGTATGGTGTTCTTAGTCATAGTGCCTTGGAAGCCCTG
TAGGATTCAGCATGTCTCGTGCTCTTCTGGGTCCCCGAGCTGTACCTTTGAGGAAAACCC
AGAGGTGGAGGTTGATTTGTGATTGAGCATGTTTCTCAGTGGGAAGAGTGTCGAAGGAGC
CTGGGGTGAAAGTACTTCAGGACCAAAGGAAAATTGCCCTTCACTCAAGAAGAGGCTTTC
CTTGAACCTGTCCCCACTGAAATATCCTCATGGCCTTCGTCTTCTCTGATGGCCAAAAGC
AGGACTTTTGATTCAGAGGTGGCAAATGAGTGGTGTTGAGAGAGTTTGTTATGCTTGGTG
CTCTGTAGCTGGAAGGAGCCCTCAAAATTCTTGTGTGCATGATAGCTTCATGCCTGCTTA
CACCCATGCACATGTCCCAATAAGAGTGGCTGCCTGTGGGAGATACATACACGATACACC
ACAGTGGAATGAATTGTATGGCCCTTGCAATGTGTGTACCTGCCTGCTGTTCTCAAACAC
ACCTGTTTTTCCTCTGAACTTTCCAGGTGGCGTGGGCATAGAAGGAAGGCCAGTGGCCAT
GAGGGACAATCTTGGTCTTGGGAGATCCTGGAAATGATAGGGAGTCCCTTGATATGTGTG
GCATGGGCTCCTTCAGGTGCTAGTGGATTCCTTAGGATGGTAAGTGTCCATTTCTCAGAA
GCTCCAGATATTCCTCCTCTGCAGGAACAAAGACTGTGCCTGGATCGATGATGACTTCCA
TATATACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCATCCTCGT
CGAACTGAGGTCCAGCACATTACTCCATCAGGGGCTAGACAGAGAGGGCCAACATTCGTT
TGTTGATATGGGTTGCATCAAGGGGTCCATCCAGGCTTAGGATGGGGTCTCGTTTGGGCA
AAGGAGAATGGCAGGGGAGTGGAGGCTATGTACACAGGAGATTCCTTGTTTGAAGGACTC
TATTTGTGAGGCCAGGGTACCACACGTGCTGTCCGCAGGAGTAGGTGAATGTGCAGGTTG
CCCAGGAAGAGTTAGCCTGTAGCCTGCCTCTGCATGGCAGTTTGTCCTTGGGTCCTGGCT
CTGGGTTTCCATGTTCCTTGGAGGAGGATAGGTGATTTTGCTTGAGAAGACAGCACAGTA
CCATACTTTTGTTGTTTTTCTGCTCATTTCATCATCCATTGAGGACAATGAAGTTGTGGT
CAGCAGGCATAGCTTTCAGGCCAGCGTGCCCATGTTGTGTCCCATGCATTGTGAGCACAT
GCATGTGGCATGAACACGTAGGCTGCCACTCCAAGCTGAGTCTGATAGGCAATGAGACTC
TGGCTTATCCTGATCCCGGTGTAGATCAAAGTCTTCCCAGTAGGATTGCATGGCCCCGAG
GCTATTGTGAGCTGCATTGCAGGTGTGGAAGCAAGGGTGTTGAGAGGGATGCTCAACATT
AGTGCTCTTTAGCGAGATGATGCACTATAAGGGCACCCTGAACCCAGACATGCATCCCTA
TGTACGTGCATTTCTGTGTCCATAAATAGTTGAAGCCAGACAGCCAGATTCCAGATGTAT
CGCAGGGGGCTGGATGACATGGCCCTTGTCACCTGTGTACCTGTCTGCCTTTCTGAAGCA
CGCTTGTGTTTCCTCTACACCTCCCAGGTAGCATTGGCATGGAAGGCAGGCCCATGTTGG
TGAGGGACAATTGTTATCTTGTGTGAGCCGCAGGGATACCAGGAAGCCCCTGGACACAAA
TGGCAAAGGCTTCTTTGGAAGTTGTTGGATCCCTTCTGCATGTAAGCAGTTCTTTCCCAG
AGTGCTCTGATTTTCCTCATTTGCAGGGACAAACACTGTGCGTGGATCAATGACTTCCAT
ATATACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCATCCTCGTT
GAACTGAGGTCCAGCACATTACTCCATCAGGGGCTAGACAGAGAGGGCCAACATTCGTTT
GTTGATATGGGTTGCATCAAGGGGTCCATCCAGGCCTAGGATGGGGTCCCTTTGGGCAAT
TGGAAGTCACAGGCAAGTGGGAGCTCCCATGCACAGGAAATTCCTTATTTGAAGGACTTC
TTTCTCCCTGGGCAGGATAACTCACCTACTGTCTGAAGGACTAGGTGAATGGCAGGTGGC
ATGGAAAGTTTGTGGGTAGTCTGCCTCTGCTGGCCAAGTTTGTTCTTGAGTCCAAGCTCT
GGATTCCCAGAGGAAGACAGATCCCCTGGTTGCGGGGAGAGCACAAGCCTACACTATTCT
CATTTGTTAGCTTGTTTTGTCCTTGGCGGAGGACGTTGTATTTCCAGGCACCCAGCATAG
CCTCTTTGCCGCATGTCCATGTCATATCCCATATGTTATGAGGATTTGTGTATTGCATGA
TCAGGCAGGCTTCTGCTCCAAGCTGGGGCTGTCAGGCAAGGAGTCTCTGGGTTATTCCAA
ACCTGATTTAGGTCAGTGGCTTCCTCTTTCAGGATTCATGGCCCCAAGGCTTTTGTGAGC
ACCATTGCAGGTGTTGAAGCAACGATGTTGAGAGGGATGCCCAACATCAGTGCTCTTTAG
CGGGATGGTGCACCTCGAGGGCCCCTGGCCCTGGGACGAGCATCTGCGTGTCCATGCATT
TCTGTGTCCATGAACAGGGGAGGCCATAGACAGGCAAATAGCAGATGTGTCACAGGGGAC
TGGATAACATGGCCCTCATGACGTGTGCAACCTGTCTGCCTTTCTGAAGCACGCCTGTGT
TTCCTCTGCACTTCACAGGTGGTGTTGGCATGAAAGGCAGGCTTGTATCATGAGGAATGA
TTGTCATCTTGTATGATTCTTGGAGATGGCAGGAAGCCCCTGGAAACACATGGTGTGGAC
TCCTTCACAGGCTGTTGAAACCCTCCTGAATGTAAGTGATTTCATTCCAAAGCACCCTGA
GTTTCCTCATTTGCAGGGATGAAACCTGTGCGTGGATCGATGATGACTTCCATATATACA
TTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCATCCTCGTCGAACTGA
GGTCCAGCACATTACTCCAACAGGGGCTAGACAGAGAAGGCCAACATCCGTTTGTTGACA
TGGGTTATACCAAGGCGTCTGTTCAGGCTTAGAATGTGGTCTCTTATGGGTGATGGGGGT
CACAGGAGAGTGGTGGCTCCCACGTATAGGAAATTTCTTGTTTGAAGGACTGTCAGTGAG
GGTGGGTAACACATGCATTGTCTGCAGGACTAGGTGAATGTCCATGTGGCCTAGCAAGAG
TTCGCTGGTAGCCCGCCTCTGGTTGCCAATTTGTTCTTGAGTTCTTGTTCTGGGTTCTCA
GGTTCCACAGAGGAAAACAGATCTGTGTGGTTGAGAGGTGGGTACAAGGCCGCATCTTTG
TCATTTGTTGGCTAACTTTGTCCTTGGTTGAGGACATTAGAGTTTTGGTCACCAGGCATA
GTCTATGTGCCTTTGTGCCCGTGTTGTATCCCATGTGTTTTGAGGACATGTATTTTGCAC
GTAAGGGTGAGCTCCTGCTCATTGCTTCTGATACCCAAGGAGTCCCTGGCTTATCCTAAA
CCCAATATAGGTTAAAGCCTTTCTCATTAGGGGCCCAGGGTCCCAAGGCTTTTGTGAGTA
TCATTGTAGGTATTGAAGCAACGATGTTGAGAAGGATGCTGAACATGCTCTTTAGTGGGA
TGATGTACTCTGAAGGCTCCTGACCCCCAGACGAGCATCCTTGTGTCCATGCACTTCTGT
GTTTATGAACAGGTGAGGCCAGAGACAGGCAGACAGCAGATGTATTGCAGGGAGCTGGAT
GACATGGCCCTTGGAACCTGTGCACATGCCTGCCTTTCTGATGCACGTCCATGTTTTCTC
TGCACCTCCCCGGTGGTGTTGGTATAAAAAGCAGGCTTACATCAGCAAGGGATGATTGTC
ATCTCATGCGATCCTGGGAGATGGCAGAAGTCCCGGGACACATGGAGTGTGGGCTCTTTC
GGAGGCTGTTGGATCCCTCCTGAATGTAAGTGATTCCTTCTTAAAGAATGCTGATTTTCC
TCATTTGCAGGGGCAAGGACTGGATCGATGACGACTTCCATATGTACTTTCCTTGGAAAG
CTGAACAAAATGAGTGAAAACTCTATACCGTCATCCTCGTCGAACTGAGGTCCAGCACAT
TACTCCATCAGGGGCTAGAGAGAGGGACAACATCCGTTTGTTGACAAGGGCTGTGTCAAC
ACTTGGGATGGGGTCGTCTTTGGGTGAAGTGGAGTAGCTGGGCATTTTGGACTTCTGTGG
CTGAGAGACAGCTTAGTTGAAGCACTTCCCTCTGCGCAGCTATGTGTGTCCTTGATTCAA
ACTCCTTGGCTCCTGCACTCCCCAGAGGAAGACAGTGGCTTCTGCATGGGGACACCACAC
AATGTTGTTCCTGTGCACTTCTTTGGTTCACTTTCACCCTCATTTGGGGACGTGGCAGTT
CCCATGGTGTTTAGGTAGCATTGAGGGCAGGCAGTCCTCAGGAGGATGTTGATGCTGATT
TGCTTTCTGCAGAGGAGCCAGAGAGGGTATCCATGTTGAACTTGTATATCCATAGGAGGA
AACCAGTCCCATGGCCCCTGAAGGGTCCTGGCAGTGGGAAGGGGAGAGGTCTGCATGTGC
ATGTACTGGACAGCCTATTCCATGTGGGTCGTGGAGTGATGACTGTGGGCCTCTTTCGGG
CATTGTAGCAGGCCCCCATTTCATTTCATGATGACCTCGGGGTGCTGGGACAGGAATGTG
ATTGCGGGTCCACGTGCTTCTGCAACTCCTCAGACCGACTTGGTTTGGAAGGTTTGTGTT
CAGGACCCTCTGTGAGATGCTTGTCTCCATTAGGCATTTGAGCTTATATCGGCCCAGGGT
TTCTACCTATCGTAGGTTGTGCATACTTTGCCTCTGAACCACTCAGGCACCTCGATGCAG
TCAACGTGCCCGATTATAAGAGTGTGACTTCCATATCCTGGTGATCTCTACTCGGAAACA
TGGTCCAGGAAGGTCTCTGTGCTTAAATACCTTAGTGGCTCGTGATGTTAGGTTATTTTC
TAATTCCTCCTAATTCTTCCCAGGAGTCTTCTTTGTGAAATAGTCATCTTGTTGTAGGAC
AGGGCTGGTATCCACAGGCAGTGATGCATAGGTTTTGCACTGCGTGGCCATGTTCAAAGG
CAAGTGCCTTAAAATGTATGGTGTTCTCAGCCACAGTGCCTTAGAAGCCATGTGGGATTC
AGTGTGTCTGGTGGTCCTCTGAGCTGCACCTGTGAGGAAGACGCTGAGGTAGAGGGTTAA
GTTGTTATTGAACGTTTTTCTCAATCTGAAAAGTGTTCAAGCAGCCCAGGGTGAAAAGTC
TTCAAGACTGAAGGAAAATTGCCTTTTGTACTGGAAGAGTTTTTCCCCAAAACTCTCCTC
ATTTAAATAGCCCTGTGGCTTGTGTCTTCTCTGATGACCAAGAGGAGGGCTTTTGAGTCG
GTGATGGCAAATGAGTGGTTTTGAGAGAGTTCTTACACTTAGGGCTCTGTAGCTTGATGG
TGCCTTCAAAATTAACACATGCCTGCTATCTTCATTCCTGGGTAGACCCATACACCCATC
CCAAAAGGGGAGTAGCCTGTGGGAAGCACATATGGGATATACCACAGTGAGTCGAGTGGA
ATGGCCCTTTTGACATGTGTACCTGCCTCCCGTTCTTAAGCACACCCATTTTTCCTCTGC
ACTTCCCAGGTGTTGTGGCCATGGAAGTAAGGCCAGTGGCTACGAGGGACAGTCTTCATC
TTGGGAGATCCCTAGAGAGGGCAGGGAGCCCCTTGACATGTGGAATGTGGTCTCCGTTGG
GTGCTGGTGGATCCCACAGGTTGGTAAATGTCCATTTTCCAAAAGCCCTGATGTTCCTTC
TTTGCAGGGATAAAAACTGTGCATGGATCGATGATGACCTCAATACATGCATTCCTTGGA
AAGCTGAACAAAATGAGTGAAAACTCTATACCGTCGTCCTCGTCAAACTGAGGTCCAGCA
CATGGCTCCAACTGGAGCTGGAGAGAGAGAGACAACTTCCATTGGTTGATGTGGGTTGCA
CTAAGCCATCCATCCAGGCTTAGGACGGGGTCCACTTTGGATCAAAGGGAGTCACAGGGC
AGTAGGTGCTCCTGTGCAGAGGAGATTCCTTGTGTGAAGGACTTCTCTTTGTGAGGCTGG
GTAGCACGCACAATGTCTGCAGGACTGGGTGAATGTGCAGGTGGCACAGAAGAGTTAGCC
GGTAACCCGCCTCTGTGTGGCCAGGTTTGTCCTTGAGTGCTGGCTCTGGGTTCCCTTGTT
CCCCAGAGGTAGATAGCTCCTTGTGGTTGGGAAGAGAGCCCAAGGCCACACCTTTGTTGT
TCTTTGGCTCATTTTTTTTTCATGGCTGAGGACTTTTTAGTGCCCATGGTGTTTTCGTAG
CAGCAGTGGAAGTCAGTTGTGAGGAGGTTGGTGATGCTTATTTTCTTTCTGGAGAGTACC
CTGTAGATCGGCTCCATTTATGATTTGTGTGTCTCCAGGGAGAAACTGAAATCCCATGGC
TGGTGATGGATACTCCAGGTGGGAATGAGAAAGTGCCATACATGTGTTGACTTGGTACCC
TAAGATGGGGATGGTCCGCCACATTTGCGAGTCTGTTTTGCATGGTGTGTACTGCACATC
ACAAATGCCATGTTGGCCTTAGGGTGCTGGGAATGGAATATGATCTGATGTCTACATGGG
AGGGCCTTTCAGCAGATTGCTTTTGTTTCCTGACAGTCTTTGCTCCATCCCCAGTCACAT
GTGTTTTTCTCCAGGGAACATTTTATTGGAGTATATCGGGTCGATATCAGAAAAAAAAAT
GTTGTGGTTATTCCAACATTAAGTGTGGTGATGTAACAGCAGTGTGGATGGTAGCTCAAG
TGAACAGTGGCAAAACCAAAATATATTGGTTTACGTAAGTGACCCTATTCTCTCCTATGT
TTGAAGTCTGGTATGCATCTCTTTCTGCAATAATCTCAGTGATCTGGAAACTTTCAGGAG
GTCTTTTTTAGGTATTTTATGTCCTTGTGGTTGTACTCATACTCCCTGCAGTGCTAAGTC
TGGGTCATTCTGCTATCCGAGTGCTACTGGAATTTCTATTGTTTTGGGGGCACTGTCTGG
TCATTGTGGATACCTCTCTTGGGGCCCTTTAACAAGAAGTATGTTAGAGGTCGGTTTTGG
GGCAGTGTTGACCTCCTGCCTAAGGTCAAAGGCAGTTTTCTTCCTAAATCTTATTTCAGG
ATTCACTGCCCAGGGGTTGTGTGACAGGGAGAGCACAAAATTAGAGTATCCCATGTGGAC
TTGTGTCCAATATCAAGGCAGTGTTGGATAATTTTCTATATCCACAAGGCTCCCACTGGA
CTCTTTATGTCCAGCAGACATTCACAGGCCAACTTTCCTCTTACACAGGGGGCCTCATTC
CTGACATGTGTAGCTTCCGTGGAACCATCCTTCAGGTTTTAAGTGCAAGGATTTCTCTCA
AGAGTTTAATTTGTTTCTTTAAGACACCGTTTTCTTCCCTATAAATTCTGCTTTCTGTGG
TTTGTAGCACAGATGAAATTGCCAGGTCATATTCTACATTTCTGCCCAATCTTGGATTAG
TGAGCCTTTGAAATATGTTCCTTGATCACTGGCAATGGTTCTTGGAATACCAGAACTTAG
TTACAAGCATTGCAGACCTACAGAGGTTTGTTGTTATTTTTAACTGCATGAAGCAGTGGG
TTTGTTTGTATCTTGTCACTCACAGCTGTCAGCAAAACTTAGGTGTTGCTAAACCAGACC
ACACCCATGAATTATAGTGCCTCTGGTTCCTTCTGTAGTAGCCTGTGGGAAGTAGATACA
GGATGCACCACAACGGAATGAATGGCATGGCCCTTGAGACCTGTGTACCTGCTTGCCTTT
CTCAAGCACACCTGTTTTGCCTCTAATTCCTAGGTGGTCTGGCATGGAAGAAGTCCAGAG
GCTGCGATGGATCATCTTTGTCTTGGGAGATTCCTGGAGATGGTGGGGAGCCCCTGGGCA
CGTGCAGCATATGTGGCGTGGGCTTCTTCAGGTGCTGGTGGATCCCTCAGGATGGTAAAT
GTCCATTTTCCAAAATCTTCTGATATTCCATCTTTGTAGGTACAAAGACTGTGCATGGAT
CGATGATGACTTTTATACATGCATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTA
TACCGTCATCTTCGTTGAACTGAGGTCCAGCACATTGCTCCAACAGTGGGTAGATAGAGA
GGGAAAACTTCCATTTGTTGACGCAGGTTACATTGAGGGGTTTGTCCAGGCTTAGGATGG
GGTCCCCTTTGGGCAAAGGGAGTCACAGGGGTGTGCGGCCTCCTGTGCACAGGAGATTCC
TTGTGTGAAGGATTTATCTCTGAGAGCAGGGTAGCACACATAACTATGCAGGAGCAGGTG
AATGTGCAGGTGGCACAGGAAGAGTTAGATGGCAGCCTGTCTCTGCACAGCGAGGTTTGA
CTTGTCCTAGCTCTGCATTCCCTCATCCCTTAGAGGAAGTTGGTTTCTTCAGAAGACTTA
AATTTGTGGAATTCAGTAGAATATTATCCACATAATGTTCCCAGTGAATGCTAGGCATAT
CACCCAAGATGGCCAGGCCTCTGGCCATAAACCATAGTAAATAGTAGGGTGTGCATATAT
CCATTAGGGAGAACCTGAAAGGTCCTTTTTTGGCCCTCCAAGGTGAATGCCTGCAAAAGC
AAGCGAAGCACGCTATCTGCATGAGCCCCATGTACCTGGCGTGGCCTGTGCTCCTCACTG
TGTGTCCCACTTCTGCTGCCCCTTCGCCTTGCCAGGTGGAGTCTGACTGATTTTTTGCCA
CTGCTGCCACCACAGGCCACCTGGAGCCCCAGCCAGTTTGAGGAAAGTGGCTCTGCTTGA
TTTTCCTTTTTTCTTTTTTTTTCCTCTTTTTTCTCCATTTCTGACTTCAGCAGGTGGGAC
TTGGAGCTTCTGCTTCTGCAGCCACAGAAGACTCCCCAGTTTGGAGGGCTGTGGCTGTGG
GCTCCCTAAGCATCTCTCTGCAGAGACTCTTTGTTTTCCATTTTACCCACCATGTCAATA
ATTTAACACAGTGGCGGAGGAGTTCATGTCTCTTCCTATTTGTCATTACTCTTCTAACTT
TCACAGCTGTACTCGGCTACTGGTCAGAATAAGAGAAAAAGCAGTGGAACCAGGAGGATC
CTACAACAAATATTCCATTTCATTTTTGTTTGTGCATATACCTTTTCTGTTTAAATGTGG
ACTTTGATTTGATATGCTTCCAGTGCAGATACAGATCCCATATGTAAGAGAGTATGGAGT
TGCATAGAAAGAAGACTTGTCATTTTCCTGTACTGTTGGTGTTCTAATATATCTTTGTGG
TTTTTGCCTCTTCTGGCTTTAGAAGATACACCAACATGGTTTTGCAACATAGCCTCTTCT
TATTTTAGTAAGGGACCAAATGTGCATGTCAGTAACAGGTGTTACCTTGAATTGGGATCA
GTGCTTGTGTGACTATATTCAGTGATGTCATTTTCTGTCACACTCAAGTCACAAAATATT
TAACCACTTATTTTTTTATCTCTGGAGGAATAATCCAAAAGATTGTACTGGTAAAGCCAG
AACAATTTCCAGTTATGCTAATTATTTGTATAATACTTAGTTGGCTTTGTCTGTGGTTTG
TTGGCTTATTTTCCTGTAGCTTTTCAAGGTTTTTCTATGAGTTCTGTTAAAGAGTCTGAA
AATGGAGCGTAGAAGACATGCTTCGATTTCCAGGATGGTTGTGTTTTCCAGAGAGGCGAA
GGTAAACCATTGGCGCAGCCCTGCCTCCCACAGATAATTCCGGGTGCAGTGTTTCATATC
TAGACTTGGACTTCTATCCTACCATACTTCTTTGTGTGCAGGTATTTTTGGGGATAAAAT
TCTTGTTTTCAGCTGTATAGATGTCTTGCACATACTCTTTTGATGGTTTGATTTATCCGT
TGTGTTCAGCACGTTTCAGTGAGCAAGATACGGGATTTAATTTCCAATATAAAATCCGTG
ACTGCTGGCCGGGCGCAGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCATGGTG
GGCAGATCACGAGATCAGGAGATCAAGATCATCCTGGCCAACATGGCAAAACCCCATCTC
TACTAAAAATACAAAAATTACCCATGCGTGGTGTTGTGTGCCTATAGTCCCAGTTACTCA
GGAGGCTGAGGCAAGAGAATCCCCTGATCCTGGGAGGTGGAGGTTGCAGTGAGCTAAGAT
CATGTCACTGTATTCCAGCCTGGGCGATAGAGACTCTGGCTCAAAAAAAAAAAAAAAATA
GACTGTTATAATTATTTTCAGCCTCATGTCTCCGTGTCACATTACAGGTCCATGAAGCTG
TGTTCTTTTTTTTTCAGAGTATTTTCTTTCTTGTCCAGATTAGCTAAATTGGATTGTTTT
ATGCTAAATTCACTTAATCACTACTCTATTATTTTTGAATTTTTTAGTTCTGTTTTTTCA
CTTGGTTCTTTTTTTAAAAAAACTTCTACTACCTTTCTGAGACTTCTACTTTTTTACTTT
TTTCAAGAAGCTTTATAATTACTTGCTAAAGCATTTTTACCATGACTGTTTTTAACTTCT
TCAGATAACCACAACATTTGGTTAATCTTGAGGTTGGCTTGGTTAACTGTCTTTTCTCAT
CCTGCTTATGATTTTCCTTCTAATTGTGATTTTTCCGGTTCTTGATAGATGGGTGATGTT
TTAGTTTATCCTGCATTGTTTTTTCCTTTTTAAGTTAGGGGAATCTGAATCTATTCAAAT
GTTTTATTTTAGCAGGCATGTGCCCTGTTTAGGTTTAATTTGAATGTCCTGTCCTACTTT
TGTAGGCCATGTTTTTGCAGGCAGTCTTGCTATCAGAGCTGAGGGGATGCTGTTTTGATC
ACTTAGTTTATCTGATGTTGCTGGGCCTCCAACTGGTGCTGACTGGTACTTCCTGAGATG
GCGAAGGTTTTTCTGTACTCTAAGATGCCGTGTATCTCTATGTAAGGGGAGGAGACTCTG
GACCACAGGAATGAAGAGAACATCTTAGGTCAGGCAGCTCAATCATATGCGATAACCTGG
GTCAACCAGCCAGTAGCCTCATGAAGTATGGGAGGGAATTCTCCAGTGTCAGCATTCAAA
GACATCATGAGTTTTTACTTCTCATTTTCTTTTAAGTGAAATAATCGCATGGAAATTAAA
GAATAAATATATGAAATATATGAAACTTATATGAAATTTAAGAATGTGAGAAGGCCTACA
GCGTGGGGATCCCCAGGCCATTTGATCAATGAATGTCTGTGTTACACATCTTTGCTCACT
TTTTCTCTATTTTTGTAGTTCATTGTGGAACCAGCACAGATTTTCATACGAAAGTTATTT
CTTTTTAACCTCAAAAAGTGACAGAATGGAGTGTATCATGAAAAAGTCTGACATCAAAAC
CTCAAAATGTGATATTGGTAAGCATTTTGTCCTGAGAATACCAGCATTTCCTCTTAGGGG
ATCATGACACTGCAGTGACCATGTGACCCTGGCTGTGCTAGTCAGCCTGGGCTGGTCATT
GACTGTGATGCTGGTCTCCATGTGATTGACTAGCGTGGGTCAGTGCCTCCAAAGGTGACA
GCTGTGTGCTCAGTGTCTGCCACATATCTCAGGCTCAAGGTCCCTTTTATAAATGTGCCT
GGATCGATGATGACTTTAAAATGGATCTCATCGGAATCTGAACAAAATGAGTGACCAAAT
CACTTCTGTGCCACTTCTGTGAGCTGAGGTCCAGCACAGGGGCCATGCCAGACAAACACA
TGGAGGGTGTTTTGTTTGGTCAGCACTGGTACTATAAAACGGCCTGTGGAATTAGACAAC
TAACCAGCTCACATACAGTACAGGAAATTACTGGACAGTTAACCTACCAATATATGGTTG
GGGGTAAGACGGACACTTTTCAAATGCTTGGCTGGTAGCATCTGTACACTACAGTGACCA
GACACTGGGAGCCAGCACAGGAGTTATAGGATTTACAGGAAATTATTGTGTGAACCCACA
AGCCATTCAGACATTTGTGTGAGCGCCCGGAATATTCTGGTTGATGGTTTGTTGCTTGAT
GGCAAAGAGATGTCAGCATTCAAAGACATCATGAGTTTTTACTTCTGCTTTTCTTTTAAG
TGAAATAATTGCATGGAAATTAAAGAATAAATATCTTATATGAAACATATGAAACATATG
AAATATAAGATATTTATTTATATCATATAAGATATAAATATCTCATATGAAATCTTGTAG
TATATTTTCATTTGATTGCCAACCCAGTCACTAGGACTGAAACAGTTGTTTATTTTTTGT
TTTCCCATCAACCAAGCAAGTTATTTAATACATGTTTCAGTGCTGGTTTCAACTACGTGT
TGCAGCAAACATTTTTAGAAGTGATATTTCAAGTTCTTGGATTTTCACATGGATTTCATT
GTCTACTTTCATATGTCCTCCATGTGTGACCACTGTATTAATTAAAAGTTGTAATAAATG
ATTTTGAAAGGTATGTGCTGGAGGAACTTTGGGACAAATGTTTTAGAAAACATTATTTCC
ATAAAATTTGGATCAAAGATATGAGCATAATTGTCCTTGTTATACAGATGGTCCAATGAG
TGTCTAATGTGAATTCTTATAACTGTTTATAACAAAGTAGTCCATTAAGCAAATTTTGTT
TCACAACTTTCCTAATTTCCCCTGTACTCTGTAGATTGGGTGAGATAGAATTCCATGGAA
TTTCATTGCCAAACCAGTGAAGTGCTAATTTTGACATTTGTACCAGCTAACGTAGCCGTG
AAGAAACACACCAATACACTTCTAAGGTAACATTCAATTTTTAGTGAATTTATTTTTGTG
AGTTATTTTTATTCTTTTAAGTAATCAAGAATTTATGTTCACAAAGATTGGTTAATACTA
ACAGTTTCAGACATTAATGTTCTGATGAGCTGAGGCATCAATCTCCTTTTTATAAAGATT
TTGTTCTTTTCTCTACTTTGAATAACATATGAAATGTCCAACAGCAGTTCTAAGTTAGTG
TATATTCCATATATGTTAATAGTGAAACATCCTGTCTTATGCAAGGCTAAAAATTGTCCG
TGTGTACTTCTCAGATTCGTATACATACTCTCTTCCTACAGGACAGCATAGACCAAGATC
TAGGTTTCATATGGATGAATTTATTCTTCCCTTTGAGGCAAGACAAGAAGGAAAGAAAGT
ATTGGGAATAATGCTGCCCTCCCATCCTCAAGGGCCAGTGGGAACTCTAATATTGGTAAG
CCTTTTGTCCTGAAAATACCAGCATTTCCTCTTAGGGAATCATAACACTCTGCTAACCGT
GAGACTCTGGCTATGCTAGTCCGCCATGGGCTGGTCACTGACTGTGATCCTGGTCTCCAT
GATTGAATAGTGTGGTCCAGTGTGTCTCAGAGTGACAGATGTGCTCAGTGTCTGCCACAT
ATCTCAGACTCAAGGTCCCTTTTATAAATGTGCCTGGATCGATGATGACTATAAAAAAAA
TGGATCTCATCGGAATCTGAACAAAATGAGTGACCAAATCATTTCTGTGCCACTTCTGTG
AGCTGAGGTCCAGCACTGGGACCATGCCAGGCAAACATGAGGAGGGAGTTTACAGGGACT
AGGGTATTGGAAAACTAACCTACCCATATATATTAGAGCAAATGAATTGTTCTCAGTTCT
GTAAATATCCAGCTGTGGTTTGACATAGCAACTCTCTTTGTATTTGCTTGGCAGCATTTA
TAGAAACAGCTGGTAGACCCTGGGGAACCAGGGCATAGTGAGATTCATGGGACGTTATTT
CACCTACTCTTGAGCCATTCACACATTTGAGCTCGCAGAATTATCTGGTCGATGATCAGT
CTCTTGAGGATAATGAGATGGTCAACATCCAAATCCAAAGATACTAATGAGATTTTACTT
TTTTTTTTGAGGTGGAGTCTCATTCTGTTGCCCAGGCTGGAGTGCAGTGGCATAATCTCG
GCTCACTGCAACCTCCACCTCCTGGGTTCAAGAGATTCTCCCGCCCCAGCATCCTGAGTA
GCTGGGATTACAGGCGCCCGCCACCACCCCTGGCTAATTTTTGTATTTGTAGTAGAGATG
GAGTTTCACCATATTGGCCAAGCTGGTCTCGAACTCCCAACCTCAGGTGATCCAGCCACC
GCAGCCTCCCAAAGTGTTGGGATTACAGGCATGAGCCACCGTGCCCGGCCTTACTTTTTA
TTTTCAATTAAGTGAAACAATTACATGGAAATTGAAAAAAAAAAAGGTACTCTAAGTAGA
CTACTCTAGTGTATTTTAATTTTCTTGCCAATTCAGCCACTAGGATTGTGTCACTTGTTT
TTTTGATTTTAGTTTTTCGTATCAAAAAGCAAACCACTGTTTATATTTGAGTGCTGGTTT
CAACTGTATGCTGCCTCAAATAAACTTAGATTATATTACAAATTCTTTTTTACATAGATT
TCATTGGCTATATTCATATATCCTCAAAGGTTTCCATTGTGTTTGAAGAGGTATCCTAAT
TGTAATAAATGCTTTTGACTGGGGATGCCAGGGAAGCTTTGAGACTAATGTCTCAGATTT
TTTTTAAAAAAGTTTATATTCTATAGTGATCAAAGATGTAAGAATAATTTTTCTTGTCAT
TCATTGGATAGTCCAGTGAGTGTCTACTGTGAATTCTTATATTCACTTGTAACTAAACAT
TCCATTTGGCAAATTTCGTTTCATAACTTCCCTAATTTCCTCTACACTTTGTAGATTGGG
TGAGATACAATTCCATGGAATTTTACCACTGAACCAGTGGAGGGCTAATTTTGTCATTTG
TACCAGTTAACTAACTTGGGAGGAAACAGAACAACACACTCCTGAGGTAGTATCCAATTT
TTAGTAAATTTATTTTTATTATTTTTCAAACTGTCAGTGATTTGGTTTGGTGAACAATAG
GTTAATACAGACAATGTTAGGAATTATTAATCTGATGCGCTATCTGAAGCATCAGTTTCC
TTTATTTTTAAGATTTTTTTCTTCTCTGTAGTTTGGATAACATTTAAAACATTACCAAGA
GTTTATAAATTAGTATATTTTCTATGCTGATTAATAATGAAACCTTTTGTCTTATACAAA
TTTTTAAAAAATGGACGTGTGTGTGCATGTGTATATATATATATATATATATATATAATC
TCTTCTCACAAGATGATGCAGACTAAAACTGCATTTTACATTTTATATGGCTAAGTTTAT
TGTTTCCTTGTGTTGTAATATGATGGAAAGTAATGGGAATAATTCTGCTTCCTGTCCTTA
GGGACCAGTAGGAATTTTCCCATGATAAGCATTTTGTCCTTAAAATACTGACATCCTGTT
AAGAGATCATGACACTCCAATGACCATGAGACCCTGGCTATGCTAGTCAGCCAGGGGGCT
GACCATTGACAGTGATGCTGGTCTCCATGATTAAATAGTGTGGGTCAGCATGTCCCAGGG
TGACAGAAAGCTGTGTGATCAGTGTCTGTCACATATCTCAGACTCAGGGTTCCTTTTTAA
AATGTGCCTGGATCGATGATGACTTAAAGATTTATCTAATTTAAATCTGAACAAAATGAG
TGACCAAAACACTTCTGTACCACTTCTGTGAGCTGAGGTCCAGCACAGAGACCACTCCAG
TCAAACATGTGTTGCCTGGAGTTGCAACTAGTTGGTCAGTTAGAAGCAACCACAGGGACT
GGGGTATTTGAAAACCACTTGAGTGCATTTATTAGAGGAAACGAATTTTACATTTGTGTA
TAAAAATTCAATTGTAGGGTAAAATGGAAACTCTGAGAGTTTGGTTGGCGGCATCTATAT
ACCATAGAAACAGAGCCTGGGAAGCAGAACAGTGAGACCCAAGAGAAATGTTCCTGCCTA
TACTTGGTCTGTTATCACATTTGCCTGAGCTACTGATTGACCTTTTGAGGGTGATGAGAT
GGTCAAAATCCAAGGATATGATGAGTTTTTACTTCTCATTTTCTTTTTTTTTTTATTATA
CTTTAAGTTTTGGGGTACATATGCAGAACGTGCAGTTTTGTTACATTGGTATACACGTGC
CATGGTGGTTTGCTGCACCCATCAACCCATCATCTACATTAGGTATTTCTCCTAATGCTA
TCCCTCCCCTAGCCCCTGACCCCCCAACAGGCCCTGGTGTGTGATGTTCCCTCCCTGTGT
CCATGTGTTCTCATTGTTCACCTCCCACTTATGAGTGAGAACATGTGGTGTTTGGTTTTC
TGTTCTCGTGTTAGTTTGCTGAAAATGATGGTTTCCAGTTTCATTCATGTCCCTGCAAAG
GACATGAACTCATGCTTTTTTATGGCTGCATAGTATTCCATGGTGTACATGTGCCACATT
TTCTTTATCCAGTCTATCATTGATGGACATTTGGGTTGGTTCCAAGTCTTTGCTATTGTG
AATAGTGCTGCAATAAACATATGTGTGCATGTGTCTTTATAGTAGCATGATTTATAATCC
TTTAGATATATACCCAGTAATGGGATTGCTGAATCAAATGGTATTTCCAGTTCTAGATCC
TAGAGGAATTGCCACACTGTCTTCCACAACGGTTGAACTAATTTACACTCCCACCAACAG
TGTAAAAGTGTTCCTATTTCTCCACATCCTCTCCAGCATTTGTTGTTTCCTGACTTTTTT
TAATGATCGCCATTCTAACTGGCATGAGATGGTATCTCATTGTGGTTTTGATACACATTT
CTGTAATGACCAGTGATGATGAGCCTTTTTTCATGTTTGTTGGCTGCATAAATGTCTTCG
TTTTACTTCTCATTTTCTTAAAGTGAAACAATTTCATGTGGTATCTTCCAAGTATATTTT
AATCAGTTGCCAACCCAGCTGCTAAGATTGAACTGTTTCTTTTGTTCTTCTCTTGTTTTT
TTCTATTAATTTAGCAAACAATTTCATATATAGTTTGCTATCCTTCTCCATGGGGCCTGC
ATCTTCAGATTCAACTAGCCATGAATTGAAAATACTTGACAAAAAATTGTATGGTTTCAT
CTGTACTGAACATGTACAATCTTTTTCTCTTTCTTTCTTTTTTTTTTTTTTTTTGAGACA
GAGTTTCACTCTGTCACCCAGGCTGGAGTGCAGTGGCACGATTTCAGCTCACTACAACCT
CTGTCCCCCGGGTTCAAGTGATTCTCCTACTTCAGCCTCCTGAATAGCTAGGATTACAGG
AGCCCATCACTGTGCCAGGGTAATTTTTGTGTTTTTAGTAGAGATGGGGTTTCACCATGT
TGGCCGGGCTGGTCTCGAACTCCTGACCTTAAGTGATCTGCCTGCATCAGCCTCCCAAAG
TGCTGGGATTACAAGCATGAGCCACCATGCCCAGCCAAGTACAGACTTTTTCTTTGGTTA
TTATTCCCTAAAACAGTACAGTATAACAACTATTTATGCAGCATTTACATTGTATTCAGC
ATCATGAGTAATCTAGAAATGATTTCCTGCATATAGGAGGATGTACATAGGTTCTATGCC
AATAGTGCACAGTGCTCGCTGTGTTTAAAGAAATATCCTAGGTATAGAATAAATAATTTT
GAAGTCAGTGTGTTGAGAAAACACTGACATGGATAGAAAATATTCTGTCTAGAATAGAAA
AAACAGAATAGAATAGAAAAAGTTCTATCTGTATCAATCTGATCAAAGATGTGAGCATAA
TTATTCTTGTCATACATATAGTCTAATGAATGTCTAAAGTGAATTCTTATAACTGCTTGT
AACAAAATATTTCATTTGGCAAATGTTGTTTCACAACTTTCCTAATTGCCCATGTACTTT
GTAGATTGGTTTTCACAGAATTCCATGGACTTTAACTGCTGAAGTAATGATGTGCTGATT
TTGTCATTTGTACCAGCTAACTCATCTGGGAGGCAACAAAACAATACTCTCCTGAGGTAA
CATCGAATTTTTAGTAAATTCATTTTTGTGTGTTGTTTTTATTATTTTTTTAAGTAATTG
AGAATTTCATTAGGTGTGCAAGGAGTCACTTAATACAAATAGTATTAGGCATTCAATACT
CTCATGAGATATCTGAGCCTTCAGTTTCTTTTATTTTAACATTTTACATTTTTCTCAACT
TTAACATCAGAAACATCCTATAAGTGTAATAAAATTCTTATACTTTACATATAGTTACAT
AGTAAATCCTCCTGTCTTATTTAAGTTTGAAAAATGAACATGTATACTTCTCATTCCCAT
GTATATAATCTCTTCCCACAGAATGAGGTGGACCAAGAAACTGGGCTTCATACGGATGAA
TTTATTTTTTTCCCCGTGTGGAGACATAAAGGAAAAGTATAGTGAATAATTCCGCCTCCC
ACCCACAAGTCCCCATGGGAATTCTCACATGTTAAAAAGCATTTTGTCCTGAAAATAACA
ACAATTTTTCTTAGGGAATCAGGACACTCCAATGACAGTGAGTCGACTCTGGCTATGCCA
GTCAGCCATGGGCTGGTCATTGTGCTGCTGGTCTCCATGATTGAATAGTGTGGGTCATTG
GTGACAGATAGCTATGTGCTCAGTGTCTGCCACATATCTCAGGTTCAAAGTCCCTTTTAT
AAATGTGCCTGGATGGATGACGACTTAAAAATGAATCTCGTTGGAATCTGAGCAAAACGA
GTGAGCAAACCACTTCTGTGTAGTTCTGTGAACTGAGGTCCAGCACAGGGACCATGCCAG
GCAAACACGTGCAGAGAGTTCAGTTTGGTCAGCAACTGGTACCAAAATGGCCTGTGGTAT
TGGAAAACAAACCCACTCACATAGCTTACAGCACATGAATTGTACAGAGGTCTGTATGTG
TTTGTATATATTTATATATGTTTGTGTACATATATCTTTGGGGATTATATGGCATTTCTT
TCAGTGTTTGGCTGGTAGTGTCCATACTCTCATAGTAAACAGAATTACACAAGAGTAGAG
GGAACAGTAGGAAATGGTTTTGCCTACCCTAGAGTCTTTTATACATGTTTTTAGGTGCTA
TAATCTTGTGTGTGAGGTCAGTCTCTCAGGTTCATTAGATGGACAGTGTAAAAGGTATTA
TGAGGGTTTACATATCTATTAAGTAAAAGAAATATATGGAAATTGAAGAGTAGCTTTTAT
CTATTAAAGAAAAGAATGTATGGAAATTGAGGGGTACTTTCTATTTGTGGAAAGTCTTAA
CATTTTAATTTCCTTATTGATCTTGTCACCAAAGTTGGAATTTAAGTTTTGCCTGTCACT
CAAAGAGAAGCTTTTTAGACATTTGATTGAGGGATTCTAGTAGATGCTATAGTAAACATT
TCTAATTGTAAAATGATTAAATTTGCAATTCATAGAGTTTTATGTGGATTTCATTGCCTG
ATATTCATTATTTTTATTAGTGGGTTTCATAGATGTTTAAAGGGAGATCCTAGTTTTATT
GTGTGATACTAAGGGAGGCCTTTTGGTCTTAGAAAACTGACTTTCAGTACTACCCATTTC
CAGGGAGTGAGCATAATTTTTATTCTCATACCACATGGGCAAGTGAATATCTATGGTTTA
TTTCTTATAACTCGTCATTAGTAATTATGAAAGTAAGAAAGTTGACAAATGAAACTCTTT
TAATTATGAGGGTTTCATTTGTCGACTTCCTACTTCCTCAGTGTGCTTTGTATATTGGAG
GTAATACTGGAATTGCATGGAATTCCTACTGCTGCTCCAGTAACCTGCTGATTTTGTCAC
ATGTACCAGATTCGTTGTCTGGCAATGAGAACAATACACTTCAGAGGTAATACTGCAATT
TTTAGTAAGTGCATTTTTCCTGGGTTAGTTCTATTATTTTATTTTAGCAAGTAAGATTAT
AATTGGTTTTTCAAGCAGTCTGTTAATCCAAATGGTGTGAGGCCCTAATAATCTGGTTAG
TCATCTGAAGTTTCTGTGTTCTTTGTACAGTATTTTTATACTTCCTCTGTTTTCGAATAA
CATTAGGATACCCTACTAGCAAAATAATTTAGTATATTTTATATACTTGTGCATAGTAAG
CCTGTTGTATATGTACACTATTTGCATGGTTGGCAAATTACATTTGCACTTTTTATTTTT
CTATAATTTTTTCCTATTTTCAAAGGTTAATGTGGACCAAAAACTAGATTTCATATAAAA
GAGTTTATTCCTTCTACTTGAGGTGTGACATGAAGGAAAGTAATGGAAATAATTCTGCCC
TCCCATTCTCAAGGGCCAGGGGGAATTCAAATATTGGTAAGCATTTTGTCTTGAAAGCAC
CAACATTCTTCTTAGGGGGTCATGACACTCCAATGACAGTGAGACCCTGGCTGTGCTTGT
CAGTCATGAGACTGGTCACTGGCTGTGATGCTGGTCTTTGTAATTGAATACTGTGGGTTG
GCAAGTCCCCAGGTGACAGAAAGATCAGTGTTCAGTGTCTGCCACATATCTCAGGCTTAA
GGTCCCTTTTATAAGTGTACCTGGATCGATGATGACTTAAAAAAATGGAAACCTTGGAAA
TCTGAACAAAATGAGTGACCAAGACACTTCTGTGAGCTGAGGTCCAGCACAGGGACCATA
CCAGGCAAACCCATGGAGGGCGTTCAGTTTGGTCAGGAACTGGTACCAAAACGAACCCAC
TTGCATATGTTAGAGCAGATTTATGTTAGAGCATATGTTAGAATTGTACAGAGGCCTATA
TATCTTTGGGAATTACATGACAATGATTTAAGTGCATGGCTGACAGCCTTCAAACACCTA
GTAATCAGGCTTTGGGGTACCAGTGTCAGAGGAGTGAACATTGTAGAAATGGCTGTGCCA
GCACTCGAGTCATTCACACTATTTTCGTAGATGCCACAACATTCTTAGTGAGTATCAGCA
TGTATAGGTATATTATGTAGTCAATTAGAAAGAAATTATCAGTCTTTGCTTGCTATTTAT
TCTTTCACTAAAAGAAATATGTGAAAATTGAAGAGTGGGTTGTATTCATGGGATTATCTT
ATTACATGCTGGAATTTGCTTCCTAACTCAGTCTCAAGGATTAGAACAGCATTTGTTTTT
CTTTTTCCTGTCACTCAGGGAGCAATTTTCTAAGCATTAGATGATAGATTAAATTAGATG
CTTCATTAAACATTTTAATGTGAAATAATGAAATTTCTAGTTCTAGGGATTTTAGGTGAA
TATTGTTGGCTAATAGGTATATTCTTTCATTGAGTCTTTGTACATTTTAAGAGAGATTCT
AATTTTAGTAATACTCGGGGCCTTTGGCCTTCGAGACCAAAATCTTGGAAATATTGATTT
TCTGTACTTACCCTGTTCCAAGCAACAAGCAGATTTTTTAGTTATGTGGATAGTCAAGTG
ACTATGGCTAATTAATTACAAACTGTTGTCAGGAATCATTCAGTTGGGAAGGTTTTGTTT
CAAAACTCCTGTAATGTCCCCTGTGCCTTGCAGAACGGAAGTGATTTTGGAATTGCATGG
AATTCTCACTGCCATCCCAAAGAAATGCTGATCTTGTCACTCTTACCTGTTTCATTCCCT
GGGGCAGAACAAAAGGACGCACTCCAAAGGTAACATCCAAGTTTGAATAAATTTACTTTT
TATGGCTTATTTTGTAATTTTTTCTGTAGTCAAGTAGATAATCAGTTTTGTGAATGATCT
GTTAATAACAGTATGAGGCATTAATTACCTGGTGAATCATCCAAGGCTTTCATTATCCTT
TATTTCCAATGTTTTTTTTTTTGCGTTCTCCCTTTTCAGTAATATCAAAAACATCCTAGT
AGAGTTATGTTAGTATATTTGATATTAATATACATAACAAACGCTCCCTTGTGCATGTTT
GACAAATGGACATATATACTTACCATCTTCCCATATTTGTACTGTTTTCACAGATGGGCA
TGAACCAAGAACTGGGTTTCATATAAAATATTTTATTCTGTCCTCTTGAGATGTGACATG
AGAAAAGTATTGAGAATACTTCTATCACCTCATCTTCAAGAATCCGTAGGAATTCTCCCA
TGGTAAGCATTTTGTCCTGAAAATACTGGCATTCCTCTTAGGAGATCGTGACACTCCAGT
GACCATGAGACCCTGGCCATGCTAGTCAGCCATTGGCCAGTCATTGACTGTGATGCCAGT
CTCCATAATTGAATGAATAGTGTGGGTCAGTGTACCCCAAGCTGATGGAAAGCTGTGTGC
TCAGTGTCTGTCACATATCCCAGGCTTAAGGTACCTTTTATAAATGTACCTGGATTGACG
ATGACTTTAAAAAAAAAAAAAATCTCATTGAAATCTGAAAAAAATGAGTGACCAAACCAC
TTCTGTGAGCTGAGGTCCAGCACACATGACAGGCAAACGTGGAGGGATGTGGATGGTCAG
TGCCCACAGGGACTGGGGTATTTGAAAGCTAATCTGCCTGCGTATGTTAGAGGAAATGAA
TTGGACAGTCATCTATAAATATCCTATTTTTTAATAAAATGGCTATTCCTTTGGTGCTTG
GCGGGTAGCATCTATCCACTGGTAGTAAACAGACCCTGGAAAACCAGCACATATGTAGTG
AGACCCCATGAGATATGATTGTGCCTACCTTTGAGCCATCCATAAGTTATCTGGGACATG
ACAGTCTTTTGAGTGAGAGCAGTTTACTAAGGTCATTTAGATCATCAGTTCCAAAGATGG
TGTGGATCTTATCGATTATTTTTTTAGGCAGAGGTAATATCTGGAAAATTAAGAGTGATT
TCTAACCATGAGAATATTTTAGTTTGTTTAAATTTGCTTGCTAACCCAGTACCAAGAATT
CAGACCTTTTTTCTGTCTGTATAAAGCAATATTCTAGACATTTGAGTGATTCAAGTAGAT
GTTGTGAGATGATTACATTTCCAGTCCTTGGAATGTTATGCGGATTTTATTGGCTAATCT
TCATATTTCATCAGTGGATTTTCCTATGCATGTTAAGGGAGATCCTTGTTAATTGATGTC
TAGGTGGACTTTATGGTTAACCTGAACAGGTCTTGGAAAAAGGACTTTAAACATTCTCCT
GTTCTGTGGAATAAGTATACTTTTTTCTGGACATACACGTTGTCAGTGAGTATGTATCAT
AATTCCTCATAACTTCTTATCAGGAAACATTCGATGTGGAAGATTTCTTTCTCAACTTCT
CTAATTGCCCCTGTGGTTTGCAGGTTCCATGTGATACTAGAGTTGCATAGATTTTTAACC
TTTACGCCAATGAAGATCTGAGGCAAACATTGCCCCTTTTTTAGAAGTTTGCATTTGTCA
CTGATAACTGTAATAATTGATCTTGTTGAAAAGCCTGGGAAATGAAGATCTGATACGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved