Pan_troglodytes Locus Mono:110:SNORA3
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:110:SNORA3
Pan_troglodytes
Mono:110:SNORA3
8
SNORA3
1001..1111
2111
TATTACATACACACACAAAAATATCAACAGAGCAAACAAAACTTAAGATTCTAAGAAGG
CTGGGGAGTTGAGCCACTGGTGTGTGCGTGCTTCTCTATCTCCTCTTCCTGTGTACAGAT
TAGGATGTGACAGAGTCTTAATTTAAAGTTTGAAACTATAATCCTCATTTCCATGAGAAT
TTGTAGTAGTAGGGAACCTGAGCTCAGCAAAGGAGGCTGCGGACGAGCCTCCAGTCTTTG
GTGAGCCTCTTGTCTTCCTGTGGACTTCACCTCCTCACCTGCCTTTGCTATCCTGGGTTA
CCATGTTTAGACTCAACTCTAGCTCAGCACCCTCTGGTCTTGGGTAGGTATCAAAAATTA
AATCTTTTTGTCTAGCCTTGGTTTCACACCCCCTCCCTTATATCTTTCCTATAACATCCA
ATAAGAGGATATCCTGCTTTCCTCCCTAGCCCAAATCGACTCGCCATGGGCACCACCATG
TCTAAATGTCAGCAGGGCACTTCCAGCCTTCCTCAGTTTGTAACGGACCATTATAGTGCA
TGGTCTTTTAAATCTGCAATAGGTACACCAGGGGTGACCCCAAATTTTAATTTCGCCTTT
ATGGATCCTGGAACCATGGTATCCTGAAGCATTTAAAGGAGGACCAGGGAAGTCACCATG
CCAACTAGATTGTTTCATGTATACATGGAAAGATTAGGTTCTGACACAAGTTCCCAAGAA
AGTAACCAAAACCTCACTAAAGATGTTGAGAGAACCACCGGGAAGTCCTGTCAATTTCCT
GTTCAAGTGTGACCCACTAAGACCACACCCCGCCTCCCATCTCACAACAGCTAAAGACCG
AATAATTGACTTCCTCCTCCTTCTCTGCCCCCAGAGTCACCCAAAATCGCCTTGAGTAGA
GTTCCAACAAGTGTCCTGATGTTCCATTTTCAAAGATGCCAACCGGAGATGCCCAGAGCT
TTGCTATAAAGTGTCTCTTAATCGCATATAATTTCAGCCTCACCAAGACTCAAGTCACAT
TCTGAGTGTCCCGGTGTGCTAGGGCACTTGCAGAGAATCTGCTGGTCTTGATTCACTGGT
GGGGGCAATCGGTGCCCAGATTATGAACATGCCCTGCCTGGGGTTTTAGACAGCGGGCTG
GCAGTCATCTTTCCTCACACCTATCAGGCAGATGGTACCTGCCATGGTGTATTGTAAAGT
TTTAAAAAAATAAAAAAATTAAAAAGAACAAAGAAAAATTCAGCCTCAAACCATTAGCAC
TGCAATCCTCAAGCCATTAAGAAGGCACATCCTAGAAATAATTAGAATATTTTCCATCTA
GAAAAGGCAGAATATGGCTGGGCATTGTGGCTCACACCTATAATCCCAGTATTTTGGAAA
GCCAAGGCAGGTGGATCACTTGAGGTCAGGAGTTCGAGACCAGCCTGATTAACATGGTGA
AACCCCATCTCTACTAAAAATACAAAATTAGCTAAGCATGGTGGTGCACACTTGTAATCC
CAGCTACTTGGAAGGCTGAGGCAGGAGAATTGCTTGAATCCAGGAGGCGGAGGTTGTAGT
GAGCCGAGATCATGCCATTGCATTCCAACCTAGGCAACAAGAGTGAAACTCCACCTAAAG
AAAAAAAAAAGAAAGAAAGAAAAGGCAGAATATTTGAATATTTCAGAATGGCTGAAAATA
AAGTTAAGTCTCTTTTCAGATAAGTCTAGGCTGCAGAAGGCCAGGAGAGAAAGGAATTGT
TTGTATTTCAAAAAAAAATCTTAGTCGACTAAGAGGCATTAAGAAGATACATTCTATATA
CATAAAGAGAAACTAGAGAAAAAGGAAAATTAAAGATTTGGGGACTAGATTATGATAAAA
TCAGCTTAGAGAATCACTTGGATTTATGCATTGTAAACTTTGGTATAATATAATAATATG
TTGGTAGGAAATGTTATATATTATAAAAGGAAGCTCAAAGAAGAGAGAGAATAAATTTTA
AAGGCTTTAATATCATTACTATTTACTAAATTAAATTGTAATGAAATACATGAAGCTGTG
TGGGTTCTAATATTGCCAGAAATTGAATAGTAGAAGATAGAATTGGGTGCCATCCAGAAC
TTGTGCATACGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved