Pan_troglodytes Locus Mono:206:SNORD59
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:206:SNORD59
Pan_troglodytes
Mono:206:SNORD59
2b
SNORD59
1001..1066
2066
CTCAAATGATTATTTTTCAAAAAAGTGAACACTTGACTTGTGAGAAGAAAGACAAAGTT
CAAAATACTCCAAACTTCACTTCAATTGTATTTTATGTGCTTAAAAAAAAAGACTATTAT
TATTATTTTTTGTACTGGTATTAAGCTAGGAGAAAAAGTTCTGTGAGTCTTCTATTATAA
GCTCTCTCCTCAAATGACTACATGAATATTAATAGATGCTTCATTAGTACTTTCATGTTA
TGGATTCTAGTGCTTCTTATGTTACTTGACAACATTAGAAATAATCACCACTGCATATTT
TTTGTTTAGATAATTACTTTGTAAAACATAGAAGTTAATTTATTTTAGATGTAGATGGTA
ATGGACATAATAAATATATGACAATTTGTTACAATTTTTTATATGCTTTGAGGAATTGTA
ACATTTTCTGGTTGAACTTGGCCAACTTCACAAATTAATATCATGATTTAAGTGAATTTG
GCATAGTACTCATTATATAAACCAGGAATAAAAATAGAAGCTGTCTTGAAACTAAATTTT
AATGACTCTTAAATTATAATTTGTTTAGTCTCATTTTGTTTCATTTCCTTGTTGTTGTCT
GGTTTTGTTTGGTTTTCTTCTACAGAGATGCTGGATACACAAATTGTACAAAAATATTCT
TTTTGTTGTTGTTGTTTTGTTTTTGTTTTTGATTTTTTGAGATGGAGTCTCTGTCAACCA
GACTGGCGTGATCTCAGCTCACTGTAACCTTCACCTCCTGAGTTCAAGCCATTCTCCTCC
TCAGCCTTACATGCAGCTGGGATTACAGGAGCCCGCCACCACGCCTGGCTAATTTTTGTA
TTTTTTAGTAGAGACTAGGTTTCGCCATGTTGGCTAGCCTGGTCTCCTGACCTCAGGTAA
TCCTCCTGCCACGGCCTCCCAAACTGCTGGGATTACAGGGGCGAGCCACCACGCCCTGCC
AAAAATATTCTTTATATATCTTTATCAATACCAGCAGAAAGCCTCATTGATTAGTAGCTT
CTGACTTTTGTTCTGTTTGCTGAAGCTAGATGCCATTCCAGATAAGAACCAAAAATAAAT
AAATAAATAAATAAAAAGAAAAACAGCAGAAAGTTTTCTTTTAACATTTGAATTTTGTTT
ATTTTAGGGGGAAATTTTTAATATGGTGACATTAAATTGCCTATGGTTGAGAGAAAAAAA
TTCAAAGCTTTTAATTATTAAAATCACTGTCTTCATGGATAATTAAGTTAAACTACCTAA
TATGAAATCATGAGAATTCAAAGGTGTATATTTAAAAAACAGAGCTTTTAAAAAATGTAG
AAAACTTTAGAGCTACTCTGTGTCTGATCTTATGAATGGCTGAAATAATTAACCATATAA
TTCTATAACCCTAATTAACCATGATTTATAGAAAATCAATAAAAGCTCACCTTCCCAAAC
TATTTTATGAATGTAATTGAAGTAATACCATTAAAACTGTATCTGTGATACAGCTATTTA
TATCTTTAGGAGAAAGTAATTAAGGATGGAAAATAAATCCACTATTAGTCATTATTTTCT
CATTGAAGAGTTATTACCTTGAGAAGAAGGGATAAATTATAAGACATTGTGAAAATCATT
TAAAAATCAATAAATAAACATTGATTCTGGAAATTAAAGAAAACCATAAGCTAATTTAGA
CAAAACGTTTGTCTTTTACTCACTGCACACATATTCATTGAGCACTCCTCTGGGTGATAA
GAATAAAAAAATGCATGCTTTCATGAAGCTTACATTCTAATGGGAATGACAGAAAAAAGT
AATTAAGCAAAATATGTAGAATATTGAAAGACATCAAAAGTGATAATTATTTATGAAATG
AAATGGATATTGCTGAAGATACGGCTCATTTTTTCTTAAGACCATATAGTAACATATGTT
GTAATTATAACTCCTCTATGTTTTTCAGATGTAATTCACTGTTTCTTAAGATTGCTTGTT
TAGTCTTACCTTACTCCAGGTCAAACTCAGCTATAAATTTTTCTCTTTACAGGTGTAGGT
AATGCAATGCCCTATGTGAGGCAAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved