Pan_troglodytes Locus Mono:64:SNORD116
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:64:SNORD116
Pan_troglodytes
Mono:64:SNORD116
13_random
SNORD116
1001..1087
2087
TGGCTACCATTCTTGAGTTCTCTAAGTAGACAGTTTCATCTATCATAAAAAGAAATCTT
ACTTTTCTATATTTGCCTCTTTTATTTTTTCCTTTCTCTACACTTTCTCTATTTCTGCTA
TACATCCCACTAAGATAAGTAACAAGGTAGCCTGGACCCCTCAGTCTTGTCACTTTCAAC
TTTTCTACTAAATATAATGGTAACTCTTGGGCTAAGTATATAGTGTTTATTGTGGCCATT
AATAAATTTGTCTTTAATACACTTTTAGAGTTTTACTGATGAATGGATTCTGAGTGTTAT
TGGATTTCTTCTCACTATCTTTTAAGCTAGTGATATGCACTGTTTTATGTTACTGGCTAC
TGTGAGGAAGTAGCCAAGATCTACTATGTATTTTGCTGCAATGAAAATAATAATATGTAC
TCTCCAGATTACTGTGAAGTTGGGAGAATACTGACAAGCAGATCACCTGAAAGTGCTGGT
TACACGGTAGATGCCGGTGAAAGATTCCCATTGCCTTTCTTGGATTTTGCTCAGCTCTAG
AGAACTGTGTCAGCTCCTCCCCAGGCGTCTGGGCACATTCTGTCCCCAGGTCCTGCCCCT
GCTTAGGTATTGTCTTTGCATTTCCATTTCCTGGTTTGGCATATCTCTGGGTCCTGGAGT
TCCTCATCTTCCTTCATCCCTGGCTCAGAGTTGGCTTCTTTTCAGACTGTGGCTCTGGCT
CTGGCTCTGGCCGTGCTGGGACTTAGCTCCTCCTCTGCTTACATACAGGCCCTTCCCCCA
ACCCCACTCCCACACTACCTTCCCGCCTCCAACCATGGATCTCCCTAGAACTCTCCACCC
CCACACCTCTGTGCTGCTGCCACTTGACATCAGACACCAAGAGTGGCTTCTTGCCAGACA
TGCCTACTGGGTTTAAACCCTTGGGTTTGACAATAAAAAAGAGAGAGGAATTGTTTACAA
CAAGAAGTTAGGCCAAAAAATGAATTTTAGAGATTAATTTGAGATTGATGATGGCACCCC
CATAAAACCATTCCTTAGGAAATCTGAACAAAATGAGTGAAGACTCATTAGTTGTTCTCA
TTGAGGCTGGGCCCCAGGATTCTGACCTTGATTCAGGATCAGGGGATCCTGATCTTGATT
CAGGATCAGGAAATTCACTTCTGTGGGGGTGCCCTGGTCCGTCCTGGCTTCCAGCTGACC
GTGGGCCAACTGCTTCCACAGCAGGAGAAATGTCCTCCGTGATGCTGGGGGCCCATGACC
TGAGGTAGGGGGAGAGATTCCAGCAGACGTGTTCCATACGGACCATCCGTGAGAATGGCT
GACCCCCACCTGGATGACTTGCTGCTGCAGCTGGACTGTGAAGCTGACCTCCCCAGCGGT
GTGGTGCTGGGGTCGCTGCACCTGCAGAATGCCACAGTGGGAGCATGCACCAGGTGCCAG
GTGGCTGCTAGGGGGACCCAACAGAGAGGGAGGCACCTCTCATGCTTCCCAGGGGTTGTC
AATGTGAGGGTGACCCCTGAGGTGGAAAAATTCATTAAAAATGAATGATTTCTCAAAACC
ACTATAGGCAACTCCCAGGTACAAAGCCTAGTTGAATGCCACTTTTTAAGAACCAATTTA
GCCCTGAGTTAAAGGTGGTGGAAATCTTCATCCTACTTGCAAATCAGCTGCGGTGCTTTA
GCCAACTTCTGCAGTGTTCTACGTTCTACTAAAGCTTACACTGAAAATGCTTAGTTAACA
AATGCACTTTATCAATACAATACAGATAAGTGTTCACCTACTATTTACAGGCAACAGCTA
GGCAACCCACTGTGTTTCCTTCAACATTTTAGCTACTGAGCTGTTAGAAGTCTGTATTAT
AGTAAAAAAACAAACAAAACAGAACAAAAAAACTTATTTTTTACTCAGGTTTCTGATATA
ACCATTTTATATCCCTCCTCTTTTACCTTCTTGGTCTTGTCATTTTATTCTTGCATTATT
ATGTAAAAACAAAAAATCTTGTCATTTTATTCTGGCATTATTATGTAAAAACAAACAATG
ACTTGGGGTCTTCATTGTGTTGCTTTTGTAGATACTGTTTTTAAAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved