Pan_troglodytes Locus Mono:127:SNORD42
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:127:SNORD42
Pan_troglodytes
Mono:127:SNORD42
4
SNORD42
1001..1069
2069
AAAGAGAGATCATTTAGTTTAATGAAAGACTCCCTCCCTCCCCAAACATCCTTCATTTC
CATTCTTAGGGGTTTAATAAATATTGGCTGCTTTATTCTATGAGTTGGCAAAATTGTCAA
GGGCCCAAGTTACTGTTTCAACCAGGTGTAACAACTTGTGTGTGTGCATGTGTATCCTGA
AATGGGTTTTTCTATATCTAAACTTTTTCCCTCTCCTTAGAGCAGAAAGATTATTAGCTT
TTCTCCAATAATTGTATATGTATCTATAGCTGGCTCCTGCTTTTTCTTTTATTTTCTTTT
CTTTCTTTTTTTTAAAGAGACAAGAGTTGCACTATGTTACCCAGGCTGGAGTGCAGTGGC
TATCCACAGGTGTGATTACAGTACACTACAGCCGCGAACCCCTGGCCTTAAGCGATCCTC
CTGCTTCAGCCTCCTGAGTAGCTGGGACTATAGGTGCATGCCACTGTGTCTGGATTCTTC
TCACTTTCTTTTCCTGTTTTCTCCCTCCTATCCTCCCTCAAGAAATTTTAAAGGTGAATT
GACTTAAAAAAAATCATTTTGTTGTCATGTGTGCACTCTAGAAATATCTAGTCCACATAA
ATAATCAAAAATTTCTAAACAGAAAAAGTTAAAAATGGTATTTTGTTATGTAAAAATGCT
AACACTGTATTTTAATTTTCATAATACTGAAGTTAAATTTCTAATGCTTTAAACTTTCTA
AATTTTTATATTGGGCTTAAGAGTCAAATAACTTATTATTTCCAAAAATTGTTTAAGATT
GGAAATATAATATGGTGTTTAATTAAATAAAAATGTAATTACAGATGTCTTTTAAAAGAT
TTTGATTATGTGAAATTCCTGTAATACTATAAAATGTGTTAATTAAAATTTTAATTTCCA
AGTTATTAAATCTTTAAGAACTTATAAAACAAATTAATTGATATATGATCTTTGGATACT
TGAACAATTTTAAATTAAAAAATGATACAAAACTCTGGTCATAGCATATGATGGAAAAAT
CTTAATCTTCTGAGACTTGTGATGTCTTCAAAGGAACCACTTCAATGCAATTTAAAGAAA
AAGAAAAGTAAAAAAAAAGCCCTCCCCAAGATGGCTGCTGAAGACGAACTACTGCTCCCG
CTGCCCCCCGCCGAGCTGCTGGAAACCGGCAAACAGATTCTGGACGAAGTAGAAGTAGCG
ACTGAACCCGCCGATTCCCGGATAGTCCAGGAGAAGGTGTTCAAGGGCCTGGATGGATCT
CCTTGAGAAGGCTGCCGAAATGTTATCGCAGCTCGAGTTGTTCAGCCGAAATGAAGATTT
GGAAGAGATTGCTTCCACCGACCTGAAGTACCTGGTGGTGCCAGTGTTTCAAGGAGCCCT
CACCATGAAACAAGTCAACTCCAGCAAGCGTCTAGATCATTTGCAGCGGGCTCGAGAACA
CTTTATAAACCACTTAACTCAGTGTCATTGCTATCATGCGGCAGAGTTTGAGCTGCCCAA
AGCCAAGAACAACTCAGCCGAAAATCACACTGCTAATTCCTCCATGGCTTATCCTAGCCT
CGTTGCTATGGCATCTCGAAGACAGGGTAAAATAGAGAGATACAAGCAGAAGAAGGAGTT
GGAGCATAGGTTGTCTGAAATGAAACCTGCTGTGGAAAGTGGTCAAGCAGATGATGAGCG
TGTTTGTGAATATTATCTTCTTCACCTTCAGCGGTGGATTGATATTAGCTTAGAAGAGAT
TGAGAACATTGACCAGGAAATAAAGATCCCGAGAGAAAGAGACTCTTCAGGAGGCATCAA
CTTCTAACTCATCTCACCAGGAGAGGCCTCCAGTGAAACCCTTCATTCTCACTCAGAACA
CGGCCCAAGCCAAAGTATTTGGAGCAGGTTATCCAAGTCTGGCAACTATGACGGTGAGTG
ACTGGTTGAGCAACATCGGAAATATGGAGCATTACGAGATCAGGAAATAGCCAAGGCAAC
ACCAGAGGAATTCAGAAAAGCGGCTCAGCAATAGGAACATCAAGAAGAAAAGGAGGAAGA
GGATGATGAACAAACACTCTACAGAGCTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved