Pan_troglodytes Locus Mono:212:SNORD88
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:212:SNORD88
Pan_troglodytes
Mono:212:SNORD88
12
SNORD88
1001..1087
2087
GTGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCTGAGGCGGGTGGATCACTTG
AGGCCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACCCCCATCTCTACTACAAAA
TACAAAAATTAGCTGGGCATGGTGGCACGTACCTGTAATCCCAGCTACTTAGGAGGCAGA
GGCAGGAGAATCACTTGAACCCAGGAGGCAGAGGCTGCCGTGAGCTGAGATCACGCCACT
GCACTCCAGCCTGGGTAACACAGCGAGATTCTCTCAAGAAAAGGAAAAAAAAAAAAAAAA
AAGAAGTGAGAATATAGAATTGAAGACTATGATCCTCTGCAATCTGGCCTCAACCCATCT
CTCCAGCTGTTTCCCATCTTCCCAAACTCTTGACCTCAGGTATATGCATCTTTACATAGT
CTCCTTGCAAAAGACACTGTTGATCAGCTACCTCAGAGCCATTCTGAATATTCTTCTCCC
TTGCTGCTCCTCACTATAGAGGCTACAAAACCCAACACACACTCTCTCTTGCAGCTATGG
ATGGCCCTGTGTGTTAGTTTTGGCCCATGAGATAAAAGTAGAACTCTGATGGGGAAACTT
TTGGGAAAGCTTCTGTTTCTTCATAAAATGGGACAGATGCAACTGATACAGCCTGTCCTC
ATCTCCCTAATTTCCTGCCTTAAACATGGATGAGATGGCAGGAGCTGCATCAGCCATCTT
GCAGCCCTGAGGGAGAGAGAAAGGCAAGTGCAGACATCAGCATTGAGTACTGAACCTGTC
TCTGGATTTCTTGCTATGTGGGAAAAAAAAACCTTCTTGGCTTAAGCTACTGTTGGTTTT
CTGTTACAGTTTCATGCATTCTTAAATGATAGATCCCTGAGCTAGGTGCTGGGCATACAA
TGGAGAACAAAGCAGGTATGGGGCTCCTCCTTATCAAACTTACAGTCTTGTGTGAGAGAC
AAAAAAAAAAAAAAAAAAAGGAAATGAATAAGTTAAAAAATTACATTCCATGATGTCCAG
CACTGGGCTCTGATCACTCTGGAGGACACAGTTTTCCCCAAGACCATGGCTACCTGGGGA
TCTGAGAGAAAAAGGAAAATAATTATACAGTGGTTTGTATTATGAAAAAAGCAAAAATAT
AATGGTATGATTGAGAACTATAGGGGAGGCTGACTCTATTTTAGCTAGAGGGGCCATTGA
AGGCCTCTTTGAAGAGGAGGTAGTTAGGATCTGTAGGATGAGAAAACCTGGCCATTTGAA
AAGGAAGTGAAAAGGGTTTTAGGCAGACAAAACAGCTAGTGCAAGGGCCCTAGGGCAAAA
AAGGGCTGTGTGTGTTCAAAGTCCACTGTGGCAGAAGGGTATTAAGGGAGAGATTGGAAA
GAAAGAAAGAAGTAGTCAGAAGGGGCCAAATCACACAAGGCCTTGCAGGTCATAAAATGG
AGTTTGAATTTTAGTCTAAGTGCAAAATAAGAATTATAAAGCAAAGATCCATTTGGAAGT
TGTGTAGAAAATGTGTCCAAGGGGGCAGGAGCAGAAATGTGGAGACCAATTAGAAGGCTG
TTGCAGGACTTCAGGCAAGAATGATGGTGATACATCCTAAGATGGTACCAGCAGAGATGG
CTTCAAGATGATTTAGGACTTGGGTCAGTAGCACTTACTGATGTAGTGGTTTGATACACA
CTGATTACCTTCTTCCTTTTTTATTCTCTGGCATTTCTCCTATATAACTAGCCACTTCTA
AAAAATATTTGTCGGCTCTTTTCTTCTGCTTGTCTCTAAATATTAGGGTTCCTGAGTCCT
TACCTAGATTTTCTTCTCTTCTTACTCCTGGCCTTTCCCTGGGAGAGTTCATAATTCACC
TACTCCATCTAGATATTTGTGATGTCCAAACACATCTCCACGTTAGGCTTCTATTTGTAG
CATCAGACCCACACTTTCAACTGTCCACTAGATAGCCTCACTTGGATGCTCTGCAGGCCT
AAATAATCTCTGTGGACAGATTAACAGGGAAAAAATATTAATAGGAAAAAATATAGATTT
TTATCTGATGTTAATATTTCTATATGGCATGGAGGACTTCACAGAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved