Pan_troglodytes Locus Mono:289:SNORA36
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:289:SNORA36
Pan_troglodytes
Mono:289:SNORA36
10
SNORA36
1001..1132
2132
AAATGCATGAACAGCAGCTTTATTCATAATATCCCATAAGTGGAAACAATCCAAATGTT
CCAGTGGTGAAACTCAACTATTTTTAAAAAAACATAAAAATACTAATGACAGAAAAGAAA
AATACTTTTAAAAGAACCGGCCGGGTACGGTGGCTCACACCTGTAATCTCAGCATTTTAG
GAGGCCAAGGCAGGTGGATCACTTGAGGTCAGGAGTTTGAAACCAGCCTGGCCAACATGG
TGAAACCCCATCTCTACTAAAAATATACAAAAATTAGCCAGGCATGTTGGCACATGCCTA
TAATTCCAGCTAACCAGGAAGCTGAGGCATAAGAACTGCTTGAACCCAGGGAGCAGAGGT
TGCAGTAAGCCAAGGTTGTGCCACTGCACTCCAGCCTGGGCAACAGAGCGAGACCCCATC
TTAAAAAGAAAAAAAGAAAAAAAAAAGAACCAAATGGAACTTCAAGAGATAAAAAAATAA
AAGAGCTACCCAGGCACGGTGGATCACACCTGTAATCCCAGCACTTTGGTAGGCCTAGGC
AGGCAGATCACTTGAGGCCAGGAGTTCAAGACCAGTCTTACAAATATGGTGAAACCTTGT
CTCTACTAAAAATACAAAAATTAGCCAAGTGTGGTGGTGTGTGCCTGTAATCCCAGCTAC
TCAGGTGGCTGAGGCACAAGAATCACTTGAACTCAGGAGGCGGAGGTTGCAGTGAGCCGA
GATCGCACCACTGCATTCCAGCCTGAGCAACAGAATGAGACTCTGTCTCAAAAAATATAT
AAAAATCAAAAATCAAAATTGATAATTCCATCAAATGGGATTAACAAAAGATTAGACACT
TCAAAAAAAAAAATCAGTGAACTTGAAGACACATCTATAGAAACTATACAACCTGAAGCA
GCCTGGGTGAGGGGATCAGTCATACCCAAACCTCAGCATTATATAATATACCCATGTAAC
AAGCCTATACATGTACCTCCTGAATCTAAAATAGAAGCTGATTCCAAAGAATTGAGTTCA
GTTCAAGGCAGCTTCCCTGTTCTGTTAACGAAACTTTGGGACATTGAAATGGGCTACGGG
AGATGATTGGTTCAAAAGCATTATTCTATTCATTTGCCTCTCTTTTTTTTTTTTTTTGGA
GACAGAGTCTCACTCTGTCACCAGGCTAGAGTGCGGTGGCACGATCTTGGCTCACTGCAA
CCTCCACCTCCCTGGTTCAAGCAATTCTCCTGCCTCAGCTTCCCGAGTAGCTGGGACTAC
AGGCACGCACCACCACGCCCAGCTAATTTTTGTATTTTTAGTGGAGACAGGGTTTCACCA
CGTTGGCCAGGATGGTCTCGATCTCTTGACCTTGTGATCCACCTGCCTCAGCCTCCCAAA
GTGCTGGGATTACAGGTGTGAGCCACCACGCCCGGCCTATTTGCCTCTCATCTTACAAAA
ATGCCTGCTTGAGTCTAATATATCAACAGTTAAAGATGCCTAGAAGAGATGGGACTGAAG
AGGCTGAAGACTTACTGAGCTTGGACTAACAGACAAGTTACATTCAGTTTTAGGAAGTCA
GGTCTGATGAACTAAGATAAAAAGAAACTGAATTATTTTCATACATGGTTGCTTTTCAGA
AATAAAAACAAAATAGAAGCTGAAATTTAAAAAACAAACAGATTTTAACATTATAAAATT
GGAAAAACAAAAATTTTGAACAATAAAGGAATATTTAATTTTTTTCTTTTTTTTTCATGA
ACCATACATGAGACTTAAGGAATATTTAACTATTTTTGGAAAACTGAAGCAGAGAAAAAA
AAAACGTCTGGACAGAATCTCAGTAACTTGTGCACCAATATCAAGTGATTTTTTTTTTCT
GAGATGGTCTCACTCTGTTGCCCAGGCTGGAGTGCAGTGGCACCATCTCAGCTCATTGCA
ACCTCCACCTCCCGGGTTCAAGCGATTCTTGTGCCTCAGCCTCCCGAGTACCTGGGATTA
TAAACGTGTGCCACCACACCCAGCTAATTTTTGTATTTTTAGTAGAGATGGGGTTTCACC
ATGTTGGCCAGGGTGGTCTCAAACTCCTGACCTCAAGCGATCCACTCACCTCAGCCTCCC
AAAGTGCTGGGATTACAGGTGTGAGCCACTGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved