Pan_troglodytes Locus Mono:52:SNORA26
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:52:SNORA26
Pan_troglodytes
Mono:52:SNORA26
1
SNORA26
1001..1114
2114
TGCAGGAATGGGGGACAACCTGAAGGTGGAGAAAAATGACATTAAGGTGGAGAAAAATG
ACAGGGTTAGTGGGTTTTCTCCTCGTGTGCGGAGACGAGAGAGTGTAGAAATAAAGACAC
AAGACAAAGAGATAAAAGAAAAGACCGCTGGGCCCGGGGGACCACTACCACCAAGACGCG
GAGACCGGTAGTGGCCCCGAATGCCAGGCTGCGCTGATATTTATTGGATACGAGACAAAG
GGGCAGGATAAGGAGTGTGAGCCATCTCCAATGATAGGTAAGGCCACATGGGTCACGTGT
CCACTGGACAGGGGGCCCTTTCCTGCCTGGCAGCCGAGGCAGAGAGAGAGAGAGGAGAAA
GAGAGAAACAGCTTACACTATTATTTCTGCTTATCAGAGATTTTTAGTACTTTCGCTAAT
TTGCTACTGCTAACTAAAAGGCAGAGCCAGGTGTACAAGATGGAACATCAAGGCAGACTA
GGAGCGTGACCACTGAAGCACAGCATCACAGGGAGACGGTTAGGCCTCCGGATAACCGTG
GGCGGGCCTGACTAATGTCAGGCCTTCCACAAGAGGTGGAGGAGTAGAGTCTTCTCTAAA
CTCCCCCGGGGAACGGGAGACTCCCTTTCCCGGTCCGCTACCGCTAGACCACGGTCCGCT
TGGCAAGGGGCATCTTCCCAGACGCTGGCGTTACCGCTAGACCAAGGAGCCCTTTGGTGG
CCCTGTCTGGGCATAACAGAAGGCTCACACTCTTGTTTTCTGGTCACTTCTCACTATGTC
TCCTCAGCTCCTATCTCTGTATGGCCTGATTTTTCCTAGGTTATGATTATAGAGCGAGGA
TTATTATAATATTGGAATAAAGAGTAATTGCTACAAACTACTGATTAATGATATATATAA
TCATATCTAAGATCTATATCTGGTATAACTATTCTTATTTTATATTTTATTATACTGGAA
CAGCTCATGTCCTCGGTCTCTTGCGTCGGCACCTGGGTGGCTTGCCGCCCACACAACCAA
ATTAAAAAATAACACAGAAGGGTAAGGTAAGTCTCCATTAAACCCAGGAAAGAGACTGGA
AAACTCCTCTTTGGATCCTGTCTATAGTCACAGGTGAAATAAAAGAAATAAAAGGAAAGA
AAAATGGGCAAAAGACTTGAATAGACCTTTCCCCAAAGAAGATATACAAATGGCCAAGAA
GCACATGAAAAGATGCTCAACATCATTAGTCATTAAGGAAATGCAAATCAAAACCAAGTT
GATAAAATGCCACTTCACACCCACTAGGGTGGCTAAAATTAAAACAAACAAAAAGCAGAA
AATGAGCGTTGGTAAGGATGTGGAGAAAGTGGAACCCTCGGATCTTGCTGGTGGGAATGT
AACATGCTACAGTTGCTGTGGAAAACAGTGGCAGTTCCTCAATAAGCTAAACATAAAATT
AGCATATGATTCAGCAATTTTACTCCTGGGTATATACCCAATACAACTGTAAACAGACAT
TCAAACAAAAACTCATACACAAATGTTTATTTTTAGCAGCACTATTCACAATTGCCAAAA
GTAAAAACAACCCAAATGTCCATCAACCCATGAATGGGTAAACAAAATGTGGTATATTTA
CACAGTGGAATAGTATTAAGCAATAAAAAGGAATGAATGTATGCTACAACATAGATGAAC
CTTGAAACCATTAAGCTAAGTGATATAAACCAGATACAAAGGCCACATATTAGGTAATCC
TATTTATTTGAAATAACCAGAATAGACAAATCAATAGAGACAAAAAGCAGATTAGTGGAT
AAGTGATTGCCGGGAGTCTGGAGATTGAGGGAGAGGATGGAAAGTAACTAATGGGTTCAG
GGTTTCCTTTTGGGCAATGAAAATGTTCTAGAACTAGGTAGTGGTGATGGTTGCACAATA
TTGTGTATGTATTAATGTTATTAATAGTAAACTTTATGTTGTGTGTATTTTACTATTTTT
ATTTTTATTTATTTATTTTTTTGGAGACAGAGTCTCACTCTGTCTCCCAGGCCGGAGTGC
AGTGGCATGATCTTGGCTCACTGCAATCTCTGCCTCGTGGGTTCAAGTGATTCTCCTGCC
TCAGCCTCCCAAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved