Pan_troglodytes Locus Mono:221:SNORA3
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:221:SNORA3
Pan_troglodytes
Mono:221:SNORA3
12
SNORA3
1001..1129
2129
AAAATTTTATTTCTGTAAATAATAAGCATTTATGTGCATCTGTGCTTGTGTTTCTGCTT
TTCTATGTGGTTTTCAATACATTTTAAGAATGATTTTAAAAGGCACGTATTGTCACCGTT
TGCTGATGGAAAGTTTGGAATAGAACATGGCATGATTTCTGCCTCCTGGTAGCTTTACTC
TGTCTAATGCCCTCCTCTTAAGTGTGAGTGGAACCTGTGGCTTGTTTCCAGCCAAAAGAA
TATAATAAAAGTGATGAGATATATGTAATTATGTGCCTGTGTTACTCTTTATAATAGCAT
ATAAAAGGTCATGTCTGATTTATCCATAGTAGCTAAGCATAGCAGCTAAGCATACTACAC
TGCAGTGCATGTAGGAGGTTCTCAATTTATTGAAAGAGTGAATAAATAACAAGCACTGTT
TGACTAAATAAATGTTATTGAAAAATTTTTAGCTTTTAGCCTTGTGAAGAGGCTGTTTTC
CTCGCTGGCTTTAAATAATCAAAATAATCAAGCTGCCGTGTAGTGAACTTCCCTTTGGAG
AGGACCACATGTCAAAAAACTAAAGGCACCATCTAGCCACAGTCAGCAGGTAACTGGGGC
AGGCATGCTGGTATCCTGCAATAAACTACAAGTTACCACAAGCCATGTGAGCTTGGGAAC
AGATCACAAAATGGAAAAAGAGTAGATGAGTCTAAACATGCAAGGCATGTTAAGGTCATG
TATTTAAGTTTAACAAGTCTTGAATTTGTCATATTGGCAATAGATAAAAATAGAAGGCTC
TTAGCTGGGAATGTACTTTAAGAATATTACTGATGAAAGATGAAGAATGTCTAATGACTG
TACAAAGCAAGAGGGAAAACTACTGTCTCCTGCAAAAATAACAATGAGATGGTTAAGAAT
CTGAATCTGGAAACTGAATATGGAGAAAGGAAAATAAAGAATGTTATGGAATTAAATTTG
TGCTATTATATGCCAGAATAAACACTCAAAACTAAGTTCGAGCTGACACTAGAGTAACAT
CCTGACACAGCTCTTGTCCTGGTGTGCTAGAGTTCTCGATGAATCTACTGGTCTTGATTC
ACTGGCAGGAGCAAACAGTGACTGTGTTAGTATGCGTATCTAAAACATGGCCTACCTAGA
TCCCAGAAGGTGTGGGTTGGGAGGCATCTTTCCTCATACTCATCAGGGAGTTGGTACCTG
CTATGGTGTATTATAAGCCATTTCTCTGTTATTCTAGGCCTACTAAAATGTTCTGTCTGG
GGAAGGAAAAGTACCCAAAGCAGCCTATCATCATGAAAGCCAAATTCTTCAGCAGAAGAG
CTGAGAAGATTAAAAGCGTTTATGAGTATGGGGCTAGTCTTGGTTACTTAAAGTCACATG
GGGGGAGGTTTATTAAATGTTAACAAATGCTTTTTAAAAATAGCTGATGTAGAAAATTCT
GTCACTTACATTATCAAAAAATAATGAAGTACCAATCTATTAAAGATGTATAGATCTTTA
AAAGACAGAAATGACAAAACTTTATTCAAAAACATAAAAGATGATAAACATAAATGAAAA
TCTGAAAATCGAATTCTGTTCATATATAAGAGGCTTAATATCATGAATATTACAGTTTTT
CTAAAATACAATCTACAGAGCCAATCTAATTCCAAAAATGTTGATATGGTTTTAAAATGA
ACTTGTCAAGAATAATTAGAATGGGCATAACCAAAACAATTTTAAAAGAACAAGGCGGAT
GAATAAATATATCCCTACCAGGATATATTATGTAGTTATACTAATTGTAGTAAAGTATGT
TGACATTGGAATAGATAAATGGACCAATTGGACATAATAGAGAGCTCAGACACAGATTCA
CACAATTGTGGAAAGTTTATACGTGACAGAAGATTTAAGAATTCAGCAGGAAAACACACA
TGGTGATGAGACAACTAGTCTTCTTGTGAAAATAATAATAAGCAGATCTCAATGTTGCTG
AAAGTAAACTCCAGGGGTATTAGATAATTAAATGTGAAAATAAAGATGTTAACTACTTAA
AAAGGATATATACGGAAATATATTAATACCTTTGTAGCAACAAAAAACTCCTAGAGATAT
TGAAAAACAAATAGGCTAATGAATTTAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved