Pan_troglodytes Locus Mono:19:SNORA2
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:19:SNORA2
Pan_troglodytes
Mono:19:SNORA2
6
SNORA2
1001..1135
2135
CCATTAATACTTTAGCTATGTTTAGTATGCATGAGTTAATGAGTGATTAGAGTACTATG
AGCAGCACAGGTTTAGAAATGCCTATTTGCCTATAGTGCAGCCTCTTATATAGGCAAAAT
AAAAGTAAGAATTTTATTTTTTCTTTTTAAAATGCAAAGTAAAATGTGTCTTTAAAACTC
TCCCAGGAGGTGAAGGGAAGCTGCCATAACACCAGGTGGGAAGGAAGACATACTGGGCTT
GGCTCATGCTTTAATTAGCTACTGTGTAAAAATGTTCAGGGATTTTCAGTTATCCACTGG
CACCCAGAGGCAATGGGTAAGGTTAACTGGAGCTAGAGCCAGTATTTTTTTCTTCCTAGA
AGGAGTAACAGCAGCAAACAGTAGGAGAGAAGATGCCAAGTTAGAAGTGCATATAGCTCT
CTTCCACAGGAGGCCTACATGCCGCCACTTGTGCTGCCGCCATGTCTCTAGTGATCCCTG
AAAAGTCCCAGCATATTTTGCCGAGTACTCAACACCAACATTGATGGGTGGCGGAAAATA
GCCTTTGCCATCACTGCCATTAAGGGTGTGGGCCGAAGATATGCTCATGTGGTGTTGAGG
AAAGCAGACATTGACCTCACCAAGAGGGCGGGAGAACTCACTGAGGATGAGGTGGAACAT
GTGATCACCATTATGCAGAATCCACACTAGTACAAGATGCCAGCCTGGTTCTTGAACAGA
CAGAAGGATGTAAAGGATGGAAAATATAGCCAGGTCCTAGCCAATGGTCTGGACAACAAG
CTCTGTGAAGACCTGGAGCGACTGAAAAAGATTCGGGCCCCTAGAGGGCTGCGTCACTTC
TGGGGCCTTCGTGTCCGAGGCCAGCACACCAAGACCACAGGCTGCCGTGGCCGCACCGTG
GGTGTGTCTAAGAAGAAGTTAAGTCTGTAGGCCTTGTCTGTTATAAATAGTTTATATACC
AAAAAAAAAAAAAAAAAAAGTGCATATAAAGTCAGCTTTCCTAGGCCCTGAATCAAGAAA
CGTGATGGTTTGCCATTGTAGCTATTGGTTTCAAACAAGAGCCAAGATTGATGCCTTTCT
TATGGTCTGTTGGCTAATCCCAGTATGAATGGCCAGTTCAGCTAGAAGAAACAGTCTTGA
AAAAAATAGAAAAAGCAAAGGAAAAAAAAGAAAAGACAGCTTTCCAAGCTAAGTAACATT
TGTGGTCAGTGAAATAATAGAAATCTAGTAATGCTAAAGTAAAACAAATTTTCAGCTTAA
AAATATTGCCTTTATTCAGAATCATAAGGGTTTTAAAAAAAAAATCTTACCATTATGAAA
GTTAAAAAAAATATAGCACTCAGTACAATGAATTACTGCATTTAATATTCAAACACTTAA
GGCACATTTCTCACAGTTTACATGTGAGAATTTAGCATGATCCAAACTCAAATATCCATT
TCTCGTATCTTTCAATGTCTGCAGCAGACACTGACTTAGAAACCTTTTTTAAAGCCATCT
CGAAATCCTCCATAGTTGTAGGCATGTGCATTTCTTCTTTGGAAAGATTTCGGATTTCCT
CTGGAGTCAAACCTTCAATGCGCCTTCTCATTGCCATCAAGGACGCATCCCTAGGTTTTA
AGTTAAAAACAACAACAACACACACAATGTTACTTTGGTTAAATGAAAACCTGTTAATAG
AAAAATTTTCAATTGATCTGTTGTAGCATTCTCTAATTATATTACATATATATGTAGTAT
TGTATAGAAACTTATTGGAATACAAAGCCTGTTGTGATTGATTTTTAAGCAGTTAAATCT
TCTGTAATGAAAAAGGATGCTAATTTAAATAATTAATACTGAATATAAAATCCCAGAAAA
AGTAAAAGTGGGGTTAAAGCTAGCAATTTGAATTTCATTATAACTATTCAATAAAATGAA
GAATAAGCATCACAGAGTCAGAAGAGAAACTGTTAACAAGAAAATTAAATATTTTCTCCA
TGTAGAGGAAAAGCTAGGTAAGTTCAGGGTTTCTCCTTTTCTCATTTGTGTTAAAAAAAA
AAAAAAAAAACTTCAGATTCAAACAGCTCTTGCCTTTTACCAAGTTTTATCCTTAATAGC
AGCCACCATTTATGCAAAGGGATAGCAATATAGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved