Pan_troglodytes Locus Mono:107:SNORA7
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:107:SNORA7
Pan_troglodytes
Mono:107:SNORA7
8
SNORA7
1001..1145
2145
ATGATTTTGTAAGTTGTTTCTGTATTTGCATTTGTTTCAAATAAATTTTTCTATCTCTG
CTTTAATTTTGTTGTTTATGCAAAAATCACTCAGGAGTAAATTGTTTAGTTTCTACGTTT
TTGTGGTTTTGAAAGTTCCTCCTGTTATTGATTTCTATTGTCATTCCAGCAGAGTCTGAG
AAGATGCTTGATATAATTTCAATTTTTCAAATTTGTTGAGACTTGCTTTATGACAGATCA
TGTGGTCAATTTTAAAGAATGTTCCATGTGCAGACAGGAAGAAGGTATATTCTGTGGTTG
TTGGATGGATTATTCTATAGATGCCTGTTAGGTCCAAATGGTCAAGTCTCAAATTAAAGT
CCAGAATTTATGTGTTAATATTCTGCCTTGATAATCTGTCTAATGCTGTTAGTGGGGTGT
TAAAGTATCCCACTAATATTGCGTGCCTATCAAAGTCTTTTGTCTAGAGATAAGTGTTTT
ATGAATCTGTGTGCTTTGATGTTAGGTGTGTAAATATTCAGGAGAGTTAGGTCTTCTTGA
ATTGAACCCTGTATCATCATGTAATGCCCTTATTTGTCCTTTTTTTACTGTTGTTGGTTT
AAATCCTATTTTATCTGATAGAATAATAGTGACCCCTGCTCTTTTTTGTTTTCCATTTGT
CTGCTATGGAAAACAAAAGTAAATGGTTTTCCATTTCCATCTCTTTACTTTGAGCCTTTG
AGTATTATTACATGTGAGATGGGTCTCTTGAAGGTAGCAGAAGAATGGGTCTTGTTTTCT
AAATACAATTTCCACTCTGTGTCTGTTAAGTGGAGTGTTTGGGCCATTTTATATTCAAGA
TCAATATTAACATGTGAGGTTTTGTCTCTGTCATGGTGTTGTTAGCTATGTGTTTTGTAG
TCTTGATGGTGTAGTTGCTTTACAGGGTCTCTGGGCTACGTGCTTGCATGTGCTTTTATG
GTAGCAAGTATTGTTCTTTCATTGCCATGTTTAGAACTCTTAATCTCCTGGGATTGTGTC
TGGCGAGTGCCCAGTATTCTGCCACCTTCAGAAGGAAGGGAAAGCAAACCTTCATGAAAG
CAGAGGCATTCATTCCATTCCCAGCTTGCTCCAGATCTGGCAGTTGGAAGACATTCTGCA
ACAATGTCAAATCAGATGAACAAACAAAAAAGAACTCCCTTAAGCATCTCTTACGGAGCC
AGTCTGGTAGTGATAAATTCCCTTAGCAATTGTTTCCCTGAATTTTATATAATTCCCTGA
ATGTTATATAATTATATAATTCCCTGAATGTTATATAAAATATGAATTATATATATGAAT
TATATATATATGAATTATATATATATGAATTGTATATATATTATATACAATGAAATAATA
ATTATATATATGTATATATATTCCATTATTTCTGTCCCTCTAGAGAACCCAAATACAGGT
GTAAACATGATGTAAGATCGTCCAGGGAAAGTTTTCTGAACTGTGATGTTGGACATGCCA
GAGGAGACTTTTACTGGAAAGAACTTTTTAAAAAGTATTCCCTGGTAAACATAAATTGCC
ACCACTTTTGCTATTACATCAGCCAGGTCACTTCCATCAACACAATTATTATTATTACAG
AGCCCTGATTTTCTTCTTTCACCACACTTTATAATTACTTACCTGTGCAATGTGTAGGAC
ACCTTGAAGGTGAGGGAAATTATAGACTTACTCCTTCTGGTAATGGCATTATAGGTACTT
TGTACCGACATTGCCACTGAGAACAACTAAAACTGCCAGATAAAATAAGGAGGGGAAAGG
CCATGATGTTTGCGTACTCCTGGTAGAGAGCACAGAAGGTCAGCAGAGCACTAAACGTCA
TTTTTTTAGGGGGTGGAGATAGGCCAAGGGCTTACTTTTAGCAGGCTCAGGAGGCCCAAG
GACAGAAATAAAGGCTGAGATAGTGCTCAGTGAGGAATGTAATTGAGGAAACACTGACAC
TTTATGCTGAGATCCTAATGGTTACATTTCAGAGTCAGCGTGAACCAGTTTCGGTTTGTT
TTACTCCTACTCCAAACCAGGAAATTGGGCAGCAAGCAGATTAGGGGATGAAGAGTAAAG
GAAGACATCCTGGCCTGAGAAGTGTTGACCTTTGTGCCTGTGAAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved