Pan_troglodytes Locus Mono:76:SNORD113
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:76:SNORD113
Pan_troglodytes
Mono:76:SNORD113
7
SNORD113
1001..1062
2062
AAAAAAAAAAAAAAAAAAAGAGTAAGGCTGGAACATAACATTTGTGAAGAACTTTACAG
TAAAAGCTTACTTTTTACTAACTTGCTTGTCTATCCAAATGCTCTAGAATTAAACTGATG
CTACAGACGAGTTTTCAAAATAGGTAATCCTGGCATAGAGTGGCTCATCATTTATCAACA
GAGTTGCGAATAACAACTATCAAAACTGCCCACAATTCCTAGTCAATTCTATCTTAAAGT
AACTTCATACAACTGATAACACTAGAGAATAACTTTTGCTTAAAGATACAAATATTTGGT
TTATAAATGCTTTCTTCTTACCCTAATTAAGTATTTAATGGAACGTTACTGTTGTATCTA
TTTTAAAGATGAGAAACTTGAGGCTTAGAAAGGTGAATAAACTTGCCCAGAATATCTACA
AATTCCCTTAAGCAACCCCACCTGGTAATATATACCTATAATCCTCAACCTGGATCTGTT
TACCTCTAAGAGGTACCTGAAGACTCTCCAAGAGGGTACACCTGGAATTTTTTTAAAGGC
ATTTCCATATCCATATGTCTGCTTTCCTAAGACTGAGCTTTGAGGATGGCCTGCTTGTTT
AAGCAAGTTCTTTTACATCTCCTCTTTCACAATTACTCATGTTATAAAATAAAGGCAGAT
GCAATAATATGGTTGAATCTTAGCAATATTAGTTTAAGAAGTCATTCCCAAAATATTACA
AACAGCATGACGCGCTTTTATAAAATTAACAACTAAAATTTTAAAATATAACCTTTTATG
AGTACATATAGATGGCAACAAAAAGTATATACAAAAGAAAACAGGGATGATGGTTACCTC
AGGTGGAGGAAGGCAAGGGGATAGGTTGGTGGGGGTAGGGGTAATATGATTAAAGTATGT
TATTTTCAGCATTCTAGCTTTTGTTTGGTAGGTTCATGGCTGCTTATTAACATTATTAAA
AATAACTAAAGTAACTAAAATAAATAAAAGAGAGCCATGCATGGACCAATGATGAGTGAC
ACAAGGATTATGATTAAACCAAGTCTATGCACCTGAGGTCCAAAAACAAAACAAAGGCAT
ACCTCTCAGCCATCTTACTATGATGCATTGCCTCAGCGTGTAAAAACCTCCTGGAGTAAC
AAACAAAGGGACAATTTGAAATATCGATATTGGGAAGCTTTCAGGCATCATAAACCCGCC
AAAGAATTTCCTTTCTAAGTGTGTGTATGATATGATGTGGGTCTCAGTCTCTGTTGGGAT
ACCTTAAATTCAGATATACTGTAGTACTGCAGAGTGGGGTAACTGGAGTGATTCCACCTT
TCTATCCTGAAGCTCAGGGAATGCATTGCTCTTGAAGGACAGCCCCATGAGAGCAAAGCA
AAGTAATCCATTAAAAAGGGCTTTTGTTCCCTCCCACAATTTAAAAGTAAGAGATTATTT
TCTTTGCTTTTTTTTTTTTTGAGATGGAATCTTGCTCTCGTGCTCTGTCACCCAGGCTGG
AGTGCAGTGGTGCTATCCCGGCTCACTCCAACCTCTGCCTCCCAGGTTCAAGCAATTCTC
CTGCCTCAGCCTCCCCAGTAGCTGGAATTACAGGCACACGCCACCATGCCTGGCTAATTT
TTGTATTTTTAGTAGAGACGGGGTTTCCCCATGTTGACCAGGCTGGTCTTGAACTCCTGA
CCTCAGGTGATCTGCCAGTCTTGGCCTCCCAAAGTGCTGAGATTACAGGCATGAGCTACC
GTACCTGGCCCCCTTAAAAGTAAGAGATTCTTTATGGATGATCTTAATACTCATCTCTAG
GAAAGATAAATTTTACCCAAGAAATAGCTTAAATAGTACAGGTTACTGATGCTGATACTT
TCAGATGGATCAGGAATGTCTTCCAGATAACCAAACTTTTATTTGCTTTCTTGAAGGTTC
AAATGCCAGCTCAGTCACTTACTTGATGTGTCTTAGGCAAATAACTGGACCTCTGTGCCT
CATTTTCCTTGTCTTTAAAAATGGGATTAACAATACTATCTACCTCATGGGGTAGTACTG
TATGTTAACATGTGCAAGCTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved