Pan_troglodytes Locus Mono:161:SNORA40
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:161:SNORA40
Pan_troglodytes
Mono:161:SNORA40
2a
SNORA40
1001..1128
2128
TTATTCTATTTTCCCCCCGTTCCATTCATACAGTAAGCACCCTACGGAGATATTTGTTA
CATTCCAGGGATAGTAGCAGTCTCTAGGAATAAAAATGAATGAATAAGGAAATGAAATAA
TGAATGAAGGAGCAAAAGAATGAATAAAATGATCCATTTTGCATGCCTAGCATTTGTTTT
GCTTTGGTTCCATATCATTAGAAATGGAGTAAATCTCTGAAGAATCAGAATAGAACGAAC
TGACTGATCTTTGATTGTATGGCCTTATATAAGTAACCTAATGTCTTAGACTCTGCATTT
TCTCATCTGTGAAATAGAGATAAGGAAACTTCCCTGCTCACCCCATAAAGTTATTGGGAA
GACAAAAGGAGCCCATATGTAAGAAAATACTTTGTAATCACTAAAACACAGCATACGATA
CTATTATAATAAGGGAAATATCTCAAAGTTTAATTTGTGACCACTAAATGTAACTTAAGT
TAGAGGTTTGAAGTTCACCTTCTATTCTTTGAAGTGTCAGTTTATTAAATTAATGATGTA
AACAAGATGAGGGAGGGGAAGCAGGCATTTAAGCCACTTTACTTTTAACCACAATTGGTG
TGCTAATTATGGATCTAATTTGGCTATTCACCAAAGCAAGGTCTTTAAGGACAATGCTAT
TCATCTTGTCCTAGGTAATTTGCATATTTGAAAGAAATGAAAATAAATTTCTTTTAAAAA
TAGACCAATTCAGATTTCTTTTATTTTAAGTTATCTTATTCACCAAAGATCCCTCATCCT
CCACCCCAACCGGGGTAGCCTCATGAGGTTTGATAGGTAGGACTTCAGAAACAAAGATGG
ATGACCAGCAGTTCATTGACTCTACAATGAGAATTATCTGAGCACAGGAAGTTCAAGCAG
GAAGTCTGGGGCATGAATCTTTGAGCAAGAATTCCCCTTGGGAGTAGAACAAGATGGCAA
GGGTAAGAAAGCTGGCTCTCCTCTTAAGAAGACAGGGAGACTAGACTTGTGCACGTTTTT
GCTTAACTTGTGGATAAAGTCTTACAGACAGGTGCAAAAAATAAATCCTCCTTTGCAACC
CAGAACTCATTGTTCAGTATGAGTTTTGATACATATAAGAAAGGATATTTTCATACCTGA
GACAGTTAACTAAGTGACGGGAGTTCTGATAACCATAAAGGTTGGTTCCAGGCCAGGCAT
AGTGGTTCATGCAAGCAATCCCCACACTTTGGGACACCAAGGTGGGAGGATTGCTTGAAG
CTAGGAGTTCAAGACCAGCTTGGGCAAGAAAGCAACACCCCATCTCCATAAAAACTTAAA
AATTAGGTGGGTGAATATTTTTCTTTATATATGAAATTTAAAAAATAAAATTTAAAAAAA
AGAAGACAGGGAGAGAAAAAAACAGCATCTGGGGACCCATCACTGTGTACTCCCAGCATG
AGAATGGTGACTAACTTTCTCCCACCAAGCCCACTTTCTAAGTGCTGTAACCCTGATACC
CAGCCCTGGGGCCTGGCTGAAATTGCAGCCAGCAAGGCAGAAACAGCACAACCATGGGGC
TGCAGATCTACCTGCTATGCCCCTTCCTGGACTGCTGGGTGCACTGGCTAATTCCATGTG
AGTGGCATTTTCTAGGCTGTGAACCAATTGCCCTACATTATCTCATTTGATTCTTATCAC
AAGCCTCTTCTTCCTTGATGCACACATTGAACTTTGGTTAGAGTTGAAAGGAGATGTCTC
AATTATGTAAGGGGAAGGATTTCTAGAGACCCTGTGTTCTTTCATTTTCTCTTATTGGGA
GAGACATTTTATGAGAAACAGAGTGGTAGCATGGAAAAGGTCAAGAACCAAAAGTTGACT
TGGGTTCTAGTAAAGCTGACCTCCAACTGACAGGCTTGAAAGCTTAGTTTCCCATTCTTC
AAGACATTGATGAGAATGTATGACAGAGATATTTTAAGGGTTAAATGTGTATAAACCATG
CAGAACAATTCCTAACAGAAAATCAACATTTAATAAATGGGAGTTATGTCCCCTTTTTGT
CTATCTTCAGGGAAAGTTTAAGGATCAAATAGTCATTCAACAAATGTTTATTGAATGCTT
GCTGTCTGGCACACACTGTTCCAGGATTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved