Pan_troglodytes Locus Mono:97:SNORD113
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:97:SNORD113
Pan_troglodytes
Mono:97:SNORD113
14
SNORD113
1001..1076
2076
GGCCCCATCTCATGTCACATTGCCCCAAGGTCTCATTCCACTCGGCTAATCTCCAAGAA
CACCGGCCAGGGCATTGGCTTTCGGGTCCTCTTAAAGACTAAAAAGTAAAGCGCTCCCCC
ATGGGTGCTGGACAGCTTGGGAGGGATTTGGGGCTGTGGGTGGTGAAATCACAGCCCTGG
GCACACACCTGCCGGCCCAATGTCACTGACAGGCTGCTCGGAGGCTTGGGGCTCCAGTGA
GAGCATATAAATATTTTTTAAAAAATATATTCGCGATAAAATAAATCCCTTGTGTCTGCA
GAACTTGCTCTGGGCATGTACCCACTCCCAATCCATCAGGAAACATGCCCTTTGCTTTGT
ATTTGTAAAAACAGAAACAAAAACAAGAACAACCCACAAGCGAACAAACAAATTAAATCC
CCCCCACACAAAATGTTTATTCTAATTATGCAAGAAATGGATTAATAATTAATACACGCA
TTAGTAAAAATCAAACACTGCAGATAAAGTCATCTTTAATGCTTCCCTCAATCCCTCCCC
ACCACCCCCCAGCAAATTAACTGCTCTTCTCAGTTTCAGGCGTCTGGTTCCAGATATTTT
TTTCTGTGCATTTGCATATGTAGATAAATATACCTCTAAAATCTACGACTTTGTTTATTT
TTTACATAAACTATATCATAGTGTACATTTCCTCTCGCAGCAGCTTGTGTTTCTTCCTTC
AAGAGTCTGCTTAGAGATAATAAAGATCAACACTATTCCTTATAACAACACCTCAGTATC
CTGCGAGCTGTACACACCAGAGTTTATTTAACCACCTTGCTGCTGGCATGAAAGCCTCAG
GTCCTTTACCCTGGTTGGGGGGTGGAGGGCGGTGAATTGGTGGCGGCAGGTGTAAGTAAT
TGCTGAGATTTGGGTTTGGGGAGTGGGCTCACGAGTGTTTATGACATTATTATAAATGAA
TATATGAGTGCATAAATTAGCAAAATAAAAGGGGGCTTTTCTGGACCAATGATGAGACAG
TGTTTATGAACAAAAGATCATGATTAATCCAGTTCTGCACAAAACACTGAGGTCCATTAG
AAGACAATAGGTCTTGGCCGTTTCATTCCTTTTAAGAGCTGTTTAATATTCCACGGTATG
TATGCACCATTGTTGATTACACTCTTTTCTACTGTTGAAAATCCCAGCTGAAAGTGCTCT
GGGGGAGGAGAAGCTTTGGTCACAGTCCTAGCCGTCAGGGTGGGTCACAGATTCATAGGT
GTTCATTAAATTATTTTTTAAAAAAGAATACATAAAAATGGTGCTTAATGCAGATCACTG
AGGAAGCGTGTCACAAATCGAGGTTTTAATTAATACGATTCTGCTCAACTAATGCCCGAT
AAAAAAGATCTAAGCTGTTTCCATTTTTTGTTGCTGTTACCAGCGACACTGCAGTGAGCA
TTCTTGCAGCTAAATCTGTAAACACATCCTCGACTGTTCCTTTACCCCAGCTTCTTAGAG
ATGGGGTGGTGGGTTAAATTGTTTGCAAAAGTTTATTTTCATTGAGTGATCTTTCTAAAA
TGGCATTGTGACCTTGTTACTGTCTTGCTTTAAAGCCTCCATCTGACTTCCTGGAGCTTC
CGGGACGGGGTCCAAAAAATAAGGCCTTATCCTGGCATGGAAGACCCTTTAGGGTCTGTC
TTGGAACTTGCCAGCCTCAGCCCCTCCCCACTGGTGTTTACCTGCTAGGCGCACCTCACC
CCCACGGGGCTACCTGTTTCTCTCAGCGGGCTCCCTACTTCTTACGCTTTGCGCAGCCAT
GCCTTTTCAGCCAGTTTCTCCCCGGCCTTAAAGAGCAGGCTTGAAATATCCCTGCTGGGG
AGCCCAAAGTTAGGTGTGCCCCACGAAACACTGTGTTCAGAAGCCCGCCGAAGTCCTGAC
CCTGGAAGTGGGATGCCTCATTGACATTTTTTCCCCAATTAAAGGGAATGTTTTGCATTT
TTCTAGAATTGATGAAACTGGTCAACTGTTAATCACCCTCCTTCCTTTGTCCCTTTCTAG
GAGCCCTAGGCTCCCCCAGTGTTGCCTGGATCTGACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved