Pan_troglodytes Locus Mono:20:SNORD28
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:20:SNORD28
Pan_troglodytes
Mono:20:SNORD28
6
SNORD28
1001..1075
2075
AAGTATCTAAGTTCATCGAAATGAGATTAATTTATTTTCCAGGTACTATATTCCAAGAA
GACTCTATTGCTGGTGTGTTTATATAAAAAGTGATAGACAAGGAAAGTCTTCATCTCTAA
TGTTGGTCCCACTCCACACCTTTCATTTCTCCTTCAGCCCGAACTCCGCATCAAGGCCCC
TCACAAAGATTGCCGTCACCTGGTATTTACCTATCCCATTCTGCAGATTCTCCAGAAAAG
AGTTACAGGTTAAAGAAGCCTCCAGCTTCTTCTGCCATCTCTCTGGAGGGTGAAATATGG
GACTTAGGGTACCTTCCCCTTAGGAGAAGCAATGGATCTGGATTCTGAAACAGGTCATTA
CCTGGGGTGGGGAGGTGAGGGGCTGAAGCTTCAAGCTGGCTCTGGTCTAGGCTCTGACAA
TCGAGGTGTCTGGATCACCCAGAGAGATTCAATATGAGAGGAAAAGAGTCTTGGATTTAG
GCCTGTTCTCTTTCTTGCATTGTATCTCTCAGTAACTTAATGCTGCTAGGTTGCAGGAGC
TGTACGCTTTTGCTAAAGAGTCACATGAATATGAATGCTAAGTCACACCACACCAAAAAA
AAGTTACAAGAAAAACCTTAAGTGATCACCATCACAACACTTATAAGGAATTCTACAGGT
GTCTTTCATTAACTAACCCATCTCAGGGGCTTACTATCATATCACTCCAATTTGGAAATA
TTTGGAAAACTAAGACAATAAAATGTGTATTTGTTAACTTGTGTGTTTTTTCTTCTCAAC
ACCTACTCAAGGCAGGGAAAGATTTTAGAGACACTAGAAGAATAAATGAGCAAAATATTC
TTTGAATTGTCCCCTTCAAATTAAAACTAAATTAAAATTAAAACAAATTAAAATTAAAAC
TCTGTTGACCTTTTGGCAAATTCTTAATTGTTTTTAGAGTTGACAACCCTGACAAGGGCT
TCTGTATCAAGAAGTCACAGAGTCAATTAAAGAGGAATCTCTTCAGATGATTTGAATTGA
TAAGCTGAGGTTCTGTGAGGAATGACAGTTAAGAGCATGTTAAAGTTGTTATGAAAAAAG
AGAAGAATCTCTGAGTCTTCATTCGATGCCAGATGCAGAACTGAAGACCTTCTGAGAAAA
CAAAGGAGCCTGGTTCTCACCTTGATGAAATGCCAGCACAGAAGCACACCCAGTGTGATC
CCCTGATGGCCAGGAGCAGTTCTCAACTCCAACACTCTTGAAATTTGGGGCCAGATAATT
CTTAGGCTGGGGGACGGGGCACTGACTGTCTTGTGCATAGCAGGATGTGGGATGTTTGGC
ACCTTACTACACGCCCACTATGTGTCAGTAGTACTCTACCCAGTTGTGAAAAGTAAAAAT
GTCAATGTCCCCTGGAGGTAGAGAGAACAACAACCCCAGTTGAGAACCACTGGCCCAAAG
CTAGGGCCAAAGCCTTTTATAAAAACTGGATTTGAAATCTGCTCAAGTACTCTGACAGAT
TTTGGATTGCAACCCCCAGATTTCTGAGCCAAAGAAGGAAAGAAAATATTTTGGTCTGAA
ATGTTTAAGGTTAAGGCTTACTGCCTGGGTACCTCAATGATTTTTAAAACCCAATATGGC
CCCAGGATAATTTCAGATTGTCAATGGCTCTAAATTCTGATGAGCCCACCAGGCTGTTAG
CTGCCATAGGTACCCGCAAGAACCACAAAAATAGTCTCTAACATGAATAGAGCTTCACAT
TCTACCCAGAATTTTTACATTTGTCATCTTATTTAAGTCTGCATGAGTTATTCATTTAGA
ATTTCCCAGTTAGGACAAAGTCTAGCTTATCTCTGAGGAACCTTGGCCAGCCACGATAAT
TTTAGTTTTCATATAGTAGATACTTTCTGATGATAATCAGGAAAAGAGCTCATCAGTGTT
TTATGGCCATTCCAGTAGGTGATACTAAGATTATGCGATCAACATGGAAGTGGATGAATA
TCTCCCTAGTTGCTATGACAGGCAGAGAAACATCCAAATTATCTAATTGTCACACGGTTA
CTCAAATACACATTTAATAGAAGAATGGCATTGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved