Pan_troglodytes Locus Poly:3:SNORD115
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Poly:3:SNORD115
Pan_troglodytes
Poly:3:SNORD115
15_random
SNORD115, SNORD115, SNORD115
1001..1082, 3550..3631, 5574..5655
6655
CAGCCCTTGGACTCGTGGGCTTTGGGCCAAGGGGGCAGCCTGCGTCCCACTGAAAGTCA
CCCCTTCCCTGTGGCTGGAAGTTATCCCTTCCTCATGGGCGAGTGTTGGGAAGGGTGGCC
TCCTGAAGTGGGAAGGCCCGCTATTGAGGGTCTGCTCCTGGCAATTTGCTGCCCATGCTG
CTTCTGAGCCATGGAGTCACCACCAGTGTGGTGGGGTCTTGGACCCGAAGAAAGGAGAAG
ACACTGTGCCCCCCGATTAGCTGAGTGTGGCCAGGCTGTGTGTTTGCGAGGTGTGAAGGG
CATGGATGGAGACTCACCAGAGAAAGCATGTGGCCCTGGGGCCCCAGGTTGTGGTTTCCA
GTATGTGCTTGGATATGGCACATGGGTGGGTGCCCACCATGCACAGGGACTGGCTATGTG
ACTGCCAGTTGTGCAGCAGCATCAGGCATACGGGCCAGCCTCCTTGGTTGACCATGAACT
GGTTGCTGGCCCTGGCCTGTGCCCAGTAGTCCTGGGGTGACCCTGGTGTCATGTAGGGGA
GCTGGCATGTGTAGTGGAGGTGCTCGTGTGGTCTGCAGTAGGGAGCAGCCCTGGCTTCTA
GCCTGAGCCCAGTGACCTGCTTGTCCTATCCTTTCAGGGTTCAGTGGCGGAGAGAGCATC
AGGTGGCCCACGTCTGTGATGGGCCAGGATTCCACATGGATCTCATCACATGGGTCCATG
GAAGGCGAGCATCCCTGAGCTGGCACACCCCACCTTCTGCCAGCATGGAGGGGTGAGGTT
GCATTTGGCACCTGTCCTCTTCCTGTTCCTCGAGATGGTGACCCCAGAGGAGGGCTTGCA
TTGGGCCCACTGTCCCCGGGCCAGTGGCCATCAGCCGGGTGCCTAGCCCCTGTTGCACTG
AAGCTCAGGCCCTTCCTGTTGCCCTGGTCTCCTGCATTGAGCTTGGGTGAGCCCATCCGG
TTGCCACTGGATGCCTAAGCAGGGAGGGGGTTCCCTGGGTTGGGTCGATGATGAGAACCT
TACGTTGTTCTGAAGAGAGATGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGG
CCCAGCCTAGGTGAGAATTTTGGAAGAGGACGCTGGGATCCCTAGGTCCCTGACAGGGCC
ACTGTATTTTGGGCTGGAGACCTGGAGTCCTTGAAGGGCATCTGGAGGGGGCCCAAACCT
GTCTCTACGTTCCTCCATGAGGCAGTCCAGGCTCCCTGTGCGAGCTTCGTGTCGGTGCTC
AGATTCCCCTTGGTGGTGCATGTGGGTGGCTCATCCCTGAGCCCCTGTTCTCCCCTTGTG
TCTTTCAGTGAACTCGTTCGCCCAGGAGGACCCCTGGCCTTGAGCAGCATAGGTCAGTGG
ATCCTGCTGGGGTCATGGGCCATGGACCAGGCCACGTGGGGTCACTGAGGGTCAGCTATC
AGGACAGGAGGGATTCCTCAGGGAGACAACCTGAATCCCCACTGGTGAGAGATTGGTTCT
CCACAAGGGCCGCCTCCTTGGGAATCTGACCCAAGGAGGACACCTTCCCTGAAGTGCTAC
AGGAGTGACATTGGTCCAGGCAGGAAAGGGTTCCATTAGTCCCATGCAGGTCAGCTCCCA
GCTGAGACTCGGTGCTAGGGTCTGGCCTTGAGGACTGCCCAAGCCACATGAAGGTGGCCC
CAGGCTGTGATTTTTGGTGCGTGCTTGGAGAGGGAGTCTGGGCACCCTCCCTGCACAGGG
GCAGGCTGTGCGTCTGCCAGGTCTACAGTGGCGCCTAGCTTCAGAGCAAGCCTCCTTGGT
TGGCCTTAGCTGGTTGGTGGCCCTGGCTCCTACCCAGGGGTCACAATGCAGCCTAGGAAG
TGCAGGGAAGCCGGCTTGGACAGTGGAGGTGCTCCAGGGGCCTGCGGTAGGGCACAGCCT
GGGCATCTTGCCTGAGCCTAGTTACTCGCCTGTCCTGTCCTTCCAGGGTTTGGTGGTGGG
GAGATACAAGGGTTCCCCAGGTCCATAACTGTCCTCGTTTCACATGGATCCCATCACATG
AGTCCATGGACGTAGAGCATGTGTAGCCAGCAGCCCCTCCCCGCTTTCCTGCATGGAATC
TTAAGGCCCTATTTGGACACCTTTCCCCGTCCCTCCAGATGGTGAGCACAGAGGAAGAAT
TGCGTTAGGCCCTTTGGCCCCGGACCAGTGTCTGTCAGCCACGTGCTCAGCCTCCCGTGC
GCTAAAGCTCAGGTCCTTCCTGTCATCCTGAGTATCCTGCACTGAGGTGTGGTGAGTCCA
TCCAGGTCCCTAGCGTACTCATGGAGTGTGTGAGTGGGGATGGAGGTGTCACATGGGTTG
GGTCAATGATGAGAACTNNNNNNNNNNNNNNNNNNNNNNNNNTTCGACCTTGGAGAGGTA
TGTGTGATTCGGCCCATGAGGTCAGGTTTTGGATTTTCAAGGATCTCTCCAAACCCATGG
CCCTGAATGGGACCGACCCTATTAAGCTATGGGCCATCCCAGTGGTGCCTCTTTGAGCCA
AGTGTGGGGTGGCACTGTTTCCATGAGGTTGGGTCAAGACTAGCTCTGGTGACCCCATGA
TGGTGCTGCAGTCTGGCCCTGGGACTCGTGAGCTTTGGGCCAAGGGTATAGCCCATGTCC
CACCAGGGGCCACACCTTCCTTGTGGGCAAGTGGCGGGCAGGGTGTCCTCCTGAGGTGAG
AAGGCCTGCTGTGGAAGGACCTGTCCAGGCTGCTTCCGAGCTATGGGGTCACCTACAGGG
TGGTGGGGTCAAGGAAAGGAGAAGACACCATGTGTCTCCCGATTGGCTGAGTGTGGCCCC
ACTCTGTGTGTGGGAGGTGTTGTGTGAGGCATGGATGGGGACATATCAGAGAACACACGA
GGCCCTGGGTCCCCAGGCTGCGATTTCCGGTGTGGTGTGGAGCAGGGCCTGGGTGCTTGC
CCTCCACACACAGAGGCAGGCTGTGCTACTGCCAGATTGGCAGCAGTACTTGGCATCCAG
GCCAGCCTCCTTGGATGGCCGTGAGACGGTAGGTGGCCCTGGCTGACACCCAGGGGCCAG
TACAGCCCTGGGGTCATGTGAGGCAACTGGAGTGGGTAGTGGAGGTGCTCAAGGTGCCTG
CAGTAGGGCATAGCCAGGGCGTCTTGCCTGAGCCCAGTGACCTACCTGCCCTGTCCTTCC
AGGGTTCAGTGGTGCAGAGGGCCAAAGTTCCCCTGTGTCCATGACACATCAGTGTTTCAC
ATGGATCCCATCACATGGGTCCATGGTGGGACAGCAATCGTGAGCTAGCATCCACCACCC
CCTTCCTGCATGGAGGCGTGAGGTTCCATTTGGACACATGTCCACCTCCTGTCCCCCAGA
TGGTGAGACTGGAAGAAAACTTTCATTAGGCCCGCTGTCCCGGGGTGAGTGGTCATCAGT
CAGGTGCCCAGCCCTTGGTGTGGTGAAGCTCAGGCTCTTCCTGGCGCCCTGCTCTCCTGC
ACGGAGCTGTGGTGAGCACATCCGGGTCCCGATGGATGCATGCGTGGGGATAGAGGGGGT
GCCCTGAGTTGGGTCAATGACGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAA
AAATCATGCTCAATAGGATTACGCTGAGGCCCAGCTTAGGTGAGAATTCTGGAAGAGGAT
GCTGGGATCCGAAGTCCCGTGGAAGGGCCACTGTATTTTGGGCTGGAGTCCTTGAGGCCC
TGAAGGACACTTTGGGGTGCCCAACCCAGTCTCTGCACTCCTCTGTGTGGCAGCCCAGGG
TCCTTGTGCAGGCTTGGTGTTGGCACTCTGGTTCCCTGGGGGTGGAGCACATCGACGGCT
CCTCCCTGAGCCCCCGTTCTCCTCTGTGTCTTTCAGTGAGCTCTTCTACCCAGGCGGGCC
CCTGCCCTTGAGCGGCATAGGTGAGTGGATCTTGCTGGGGTCACGGGCCAAGAGCCAGGC
CACGGGGGGTCGCTGAGGGTCACCTTTCAGGCCACGAGGGTTTCCTTAGGGAGCTGACCT
GAATCCCCACCAGAGATGGATGGTTTCTCCAGAAGGGCGGCTTCCTTGTTAATTGATCCC
AAGAAGGACGCCTTCCCTGAAACCCTGCAGGGGTAATGGAGGTCCAGGCAGCAGAGAGTT
CCTTCAACCCAATGCAGTGCAGCAGCTTGTTGCCTTGATGCTCCCCCTCCCTGGAGAAAG
GTGGGCATAGGGCCCATGGAGTTGAGTTGCAGAGATTTAAGGATCGCACAGGACTTATTG
CCCTAAATGGGACTGACCCTGTTGAGCAACGTGCCATCCCATGGTACCTCTTTGGGCACT
TGGTGCATGGGTCAGGTGTGGAACACTGCCCAGGCCACATGAGGGGTCCACTGGGTCTCT
GGGGGCCACGGGTGTTATGCAGGAGCTCTCCGTCCCCAAGGCTTGCAGGGGGGTAGGATG
TCGGTGATCGAGCTTATGCAGTCAGGCCGTGAAGATTCAAGGATTGGGCCCAACCCATGG
CCCTGATGGGACCGACCCTGTTGAGCAATGGGCTATCCCACTGGTGCCTCCTTGAGCCTG
GTGGGGGCAGTGCGGCCTCAGTGGGCTTGGATCAAGGCTGAGCTCTGGCCAGCACCTGGT
GTTTGGCCCTGGGAATCGTGGGCTTTGGGCCAAGGGTTCAGCCTGTGTCCCACTGGAGTT
CATCCCTACCGGAAGTGGAGTGGATGGAAGGGTGGCATCCTGTGGTGGAAGACCCACCGT
TAAGGGTCCTGTCCTGGCAATTTGATGCCCAGGCTACTTCTGAGCCATGGAGTCACCTCC
AGGGTAGCAGGGTCTTGAGCCAAAGGAAAGGTGAGGACATCATGTGGCCTCTGATTGGCC
GAGCGTGGCCCAGCTCTGTTTTTAGGAGGTGTGCGGTGCATGAATGGGGACCCACCAGAG
AAGGCATGTGGCCCTGGGGCCCCAGGATGTGATTTCTGGTGTGTGCTTATAAAGGGTGCC
TGGATGGGTTCATTTAATGCCCAGGGGCAGGCCATGTGACTGCCAGGTCTGCAGTGGTAC
GAGGCATCCAGGCCAGCCTCCTTGATTTGCTGTGAGCTAGTTGGTGCCCATGGCCCTGCC
CAGTGGTCCTGATGCAGCCCAGATTCGAGCAGGGGATTTGGCGTGGGCAGTGGAGGTGCT
CCGGGGTCCTGCACTAGGGTGCAGCCTGGGCGTTTTGCTCGAACCCTGTGACCCTCCTGC
CCCGTCCTTCCAGGGTTCAGTGGCCAAGGGTTCCTCGCGTAAATGACCATCACTGTTTTA
CATGGATCTCATCTCATGAGTCCATGGAGGGAGAGCATGTGTGAGCCAGCACCCCCTGCC
CACTTTCCTGCATGGAGGCATGAGGCCTTGTTTGGACACCTGTCCCCCACCCCTCCAGAT
GGTGACCCCAGAGGAAGACTTGCATTGGGCCCACTGGCTCTGGGCTCAGCCTCTGGTGAG
CTGAAGCTCAGGCCCTTCCTGGCACCCTGGTCTGCTGCACTGAGCTGCGGTGAGCCCATC
TGGGTCCCACTGGATGCATGGGTTGCGGGGCAGTGGAGGGTGATGCCCTGGGTTGGGTCG
ATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAG
GATTACGCTGAGGCCCAGCCTAGGTGAGAATTTTGGAAGAAGATGCTGGGATCCAGAGTT
CCCTGGAATGACCAATGTATTTTGGGCTGGAGACCTTGAGGCCCTGAACAGCATCTCGTG
GGGGCCCAACCCCTTCTCCGTGCTCCTCTGTGAGGCAGCCCAGGCTCCCTGTGTGGGCTT
GGTGTTAGTGCTCCGCTTCTGTGAACCCCCATTCTCCCCTTGTGTCTTTCAGTGAGCTCT
TCCACCCAGGTGCAACCCCCTGGCATTGACCAGCATAGGTGAGTGGTCCCACTGGGGTCA
TGGGTCATCAGTCATGCAGTGTGGGGTCACCAAGGGTCAGCCTTTGAGACAGGAGGGTTT
CCCACAGCAGCTGACCTGAATCCACACATGGAGGGGTGGGTTGGTCCTCCAGANGGCTGT
TTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNGCACAGCAGAATGGAGACGGGAGGGCTGA
GGATGTGTCCCAGACAGTCCAAGGGACACAGCAGGGAAAGAGATGTCGGGCAGCAAGAGA
CGGAGAGCAAAGCTTGGGCCTGACAGCATGGACCTACTTCTTGAATCCCAGAAGGCAAAG
TGCATACCCAGCCTACTGTGAGCTCATCCTCATCCCTGCCACTCAATTCACAGACAGTTC
TAAGAGTTGATACAGAAAATTAATTATATTTCATATATTCAATAGGTTAGACACAAACAT
TTCCTAATTAACTTTATTTCTAATAACATTACACCCCCTGCCAAAGCAATATTCTTATCT
GAGGCCAGAGTTTGCAGTGGGAAGATGTAGAAAAGGAGAATGGGATCTATCCTGGTCTGG
GAATTCTGTAAGAGTCTAGGAAGGCAGATGGAGCATGTGATAGCCTGATGACACGACAAT
TTGTCACAGACTCCTGAAGAAACCACTAGCATTCTAAATGGGCAACTCACGGGCGTCATG
ATTTCATTTCTCTTAAAACCTGTGATTTTCCTGTGAACAATTTCTTTTCATAAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved