Pan_troglodytes Locus Poly:14:SNORA33
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Poly:14:SNORA33
Pan_troglodytes
Poly:14:SNORA33
3
SNORA33, SNORA33
1001..1124, 3939..4049
5049
AATCTTCCTTGTGAAGAGGCTTGGAATAAGAGAGCTATGATCATGTTCTCAGGGCCCAG
TGCAAAATGTAAATGCAGGGCACCTTGTTAAAAAAAAAATTTTTTTTTTTTTTGAGTTGG
AGTTTCACTCTGTCGCCCAGGCTGGAGTGCAGTGGTGCAATACCAGCTCACTGCAAGCTC
CGCCTCCCGGGTTCACACTAATTCTCCCGCCTCAGCCTTCCCAGTAGCTGGGACTACAGG
CACCTGCCACCACGCCCGGCTAATTTTTTTTTTTTTTTTTTTGTATTTTTAGTAGAGACG
GGGTTTCACCGTGTGTTAGCCAGGATGGTCTCTATCTCCCAACCCCGTGATCTGCCCACC
TTGGCCTCCCAAAGTGCTGGGATTACAAGCGTGAGCCACTGCACCCGGCCCCCTTGTTAA
AAAATTATCAAGAATTTAAAGATGGCTGACAACAGAGCATTTAATTGAGTGTCCAAGAGC
AATCCTGCCGTTTCTGAGAGCAGAGTCCTGGGCAACTGCACAAGGCTGCAGGCCTCTAGA
CGCATGCCATGCCCCTAGACCTCAACTGTTTTTCCCATCAAAAATCAGTATCACCAGCTT
TTGTCCTGCCCAACTTTCCAAACTTGGCTGCCATTAATTTCTCACATCCCTGCATGCACT
AGCCACTCCCCTTAAGTAGAGGTGAAGAGAATTCCTCTTCTTCTTCTCCCATAACATGTT
TTAAATTTAAAACAAAGAAATTTAACCAGGAGTGGTGGCTCACACCTATAATCCCAGCGT
TTTAGGAGGCTTGAGGCAGGAGGATCACTTGAGCCTAGGAGTCCAAGACCAGCCTGGGCA
AAGTAGCAAGACTTCATCTCTACAAAAAATAAAATTAGTAGGGCATGGTGGCACGCACCT
GTAATCCCAGCTACTCGGGAGACTGAGGCGGGAAAATCATTGAGCCCAGGAGTTCGAGGC
TGCAGTGAGCTGTGATCCCACCACTGCACTCCAGCCTGGCTGACAGAGTGAGACCCCATC
TCAAAAAAAAAAAAAAAAAAAAAAAATTAAGCTGGTGATAGTAAAGCCATGTTATGAGCT
TTAACGACATTGAAGTCATTAAGATTCCTGGAAATGGCTACAAAAAATTTTTAAAAAACA
AAAACCAGAGGAGCCAAGATGGCCGAACAGGAACAGCTCCGTTCTACAGCTCCCAGCATG
AGCAATGCAGAAGACAGGTGATTTCTGCATTTCCATCTGAGGTACCAGGTTCATCTCACT
AGGGAATGCCAGACAGTGGGCACAGGACAGTGGGTGTAGCACACCTTGCGCCAGCCGAAG
CAAGGCGAGGCATTGCCTCCCTCAGGAAGCACAAGGGAGTTCCCTTTCCTGGTCAAGGAA
AGGGGTGACAGATGGCACCTGGAAAATCGGGCCACTTCCACCCGAATACTGCACTTTTCC
GACACGCTTAGGAAATGGCGCACCAGGAGATTATATCCTGCACATGGCTCAGAGGGTCCT
ACGCCCACGGAGTCTCGCTGATTGCTAGCACAGCAGTCTGAGATGAAACTGCAAGGTAGC
AGCGAGGCTGGGGGAGGGGCACCCGCCATTGCCCAGGCTCGCTTAGGTAAACAAAGCAGC
TGGGAAGCTCGAACTGGGTGGAGCCCACCACAGTTCAAAGAGGCCTGCCTGCCTCTGTAG
GCTCCACCTCTGGGGGCAGGGCACAGACAAACAAAAAGACAGCAGTAACCTCTGCAGACT
TAAATGTCCCTGTCTGACAGCTTTGAGGAGAGCAGTGGTTCTCCCAGCATGCAGCTGGAG
ATCTGAGAACGGGCAGACTGCCTCCTCAAGTGGGTCCCTGACCCCTGACCCCTGAGCAGC
CTAACTGGGAGGCACCCCCTAGCAGGGGCAGACTGACACCTCACACGGCCGGGTACTCCT
CTGAGACAAAACTTCCAGAGGAACGATCAGACAGCAGCATTCGTGGATCGTGAAAATCTG
CAGTTCTGCAGACACTGCTGCTGATACCCAGGCAAACAGGGTCTGGAGTGGACCTCTAGC
AAACTCCAACAGACCTGCAGCTGAGGGTCCCGTCTGTTAGAAGGAAAACTAACAAACAGA
AAGGCCATCCACACCAAAAACCCATCTGTACATCACCACCATCAAAGACCAAAAGTAGAT
AAAACCACAAAGATGGGGAAAAAACAGAACAGAAAAACTGGAAACTCTAAAAAGCAGAGC
GCCTCTCCTCCTCCAAAGGAATGCAGTTCCTCACCAGCAATGGAACAAAGCTGGATGGAG
AATGACTTTGACGAGTTGAGAGAAGAAGGCTTCAGATGATCAACCTACTCCGAGCTGCAG
GAGGAAATTCAAACCAAAGGCAAAGAAGTTGAAAACTTTGAAAAAACTTTAGACGAATGT
ATAACTAGAATAACCAATACAGAGAAGTGCTTAAAGGAGCTGATGGAGCTGAAAGCCAAG
GCTTGAGAACTACGTGAAGAATGCAGAAGCCTCAGGAGCCGATGCGACCAACTGGAAGAA
AGGGTATCAGTGATGGAAGATGAAATGAATGAAATGAAGCGAGAAGGGAAGTGTGGAGAA
AAAAGAATAAAAAGAAACGAACAAAGCCTCCAAGAAATATGGGACTATGTGAAAAGACCA
AATCTGCGTCTGATTGGTGTACCTGAAAGTGATGGGGAGAATGAAACCAAGTTGGAAAAC
ACTCTGCAGGATATTATCCAGGAGAACTTCCCCAATCTAGCGAGGCAGGCCAACATTCAG
ATTCAGGAAATACAGAGAATGCCACAAAGATACTCCTCGAGAAGAACAACTCCAAGACAC
ATAATTGTCAGATTCACCAAAGTTGAATTGAAGGAAAAAATGTTAAGGGCAGCCAGAGAG
AAAGGTCGGGTTACTCACAAAGGGAAGCCCATCAGACTAACAGCGGATCTCTCGGCAGAA
ACCCTACAACTCAGAAGAGACTGGGGGCCAATATTCAGCATTCTTAAAGGAAAGAATTTT
CAACCCGGAATTTCATATCCAGCCAAACTAAGCTTCATAAGTGAAGGAGAAATAAAATAC
TTTACAGACAAGCAAATGCTGAGAGATTTTGTCACCACCAGGCCTGCCCTAAAAGAGCTC
CTGAAGGAAGCACTAAACATGGAAAGGCACAACCAGTACCAGCCACTGCAAAATCATGCC
AAAATGTAAAGACCATCAAGACTAGGAAGAAACTGCATCAACTAACGAGCCAAAAAACCA
GCTAACATCATAATGACAGGATCAAACTCACACATAACAATATTAACTTTAAATGTAAAT
GGACTAAATGCTCCAATTAAAAGACACAGACTGGCAAATTGGATAAAGAGTCAAGACCCA
TCAGTGTGCTGTATTCAGGAAACCCATCTCACGTGCAGAGACACACATAGGCTCAAAATA
AAAGGATGGAGGAAGATCTACCAAGCAAATGGAAAACAAAAAAAGGCAGGGGTTGCAATC
CTAGTCTCTGATAAAACAGACTTTAAACCAACAAAGATCAAAAGAGACAAAGAAGGCCAT
NNNNNNNNNNAACTTGGCTGCCATTAATTTCTCACATCCCTGCATGCACTACCCATAACG
CTTAAGTAGAGGTGAAGAGAATTCCTCTTCTTCTTCTCCATAACATGTTTTAAATTTAAA
AAAAAGAAATTTAACCAGGAGTGGTGGCTCACACCTATAATCCCAGCGTTTTAGGAGGCT
TGAGGCAGGAGGATCACTTGAGCCTAGGAGTCCAAGACCAGCCTGGGCAAAGTAGCAAGA
CTTCATCTCTACAAAAAATAAAATTAGTAGGGCATGGTGGCACGCACCTGTAATCCCAGC
TACTCGGGAGACGGAGGCGGGAAAATCATTGAGCCCAGGAGTTCGAGGCTGCAGTGAGCT
GTGATCCCACCACTGCACTCCAGCCTGGCTGACAGAGTGAGACCCCATCTCAAAAAAAAA
AAAAAAAAAAATTAAGCTGGTGATAGTAAAGCCATGTTATGAGCTTTAACGACATTGAAG
TCATTAAGATTCCTGGAAATGGCTACAAAAAATTTTTAAAAAACAAAAACCAGAGGAGCC
AAGATGGCCGAACAGGAACAGCTCCGTTCTACAGCTCCCAGCGTGAGCAATGCAGAAGAC
GGGTGATTTCTGCATTTCCATCTGAGGTACCAGGTTCATCTCACTAGGGAATGCCAGACA
GTGGGCACAGGACAGTGGGTGTAGCACACCTTGCGCCAGCCGAAGCAAGGCGAGGCATTG
CCTCCCTCAGGAAGCGCAAGGGAGTTCCCTTTCCTGGTCAAGGAAAGGGGTGACAGATGG
CACCTGGAAAATCGGGCCACTCCCACCCGAATACTGCGCTTTTCCGACAGGCTTAGGAAA
TGGCGCACCAGGAGATTATATCCTGCACATGGCTCAGAGGGTCCTACGCCCACGGAGTCT
CGCTGATTGCTAGCACAGCAGTCTGAGATGAAACTGCAAGGTAGCAGCGAGGCTGGGGGA
GGGGCACCCGCCATTGCCCAGGCTCGCTTAGGTAAACAAAGCAGCTGGGAAGCTCGAACT
GGGTGGAGCCCACCACAGTTCAAAGAGGCCTGCCTGCCTCTGTAGGCTCCACCTCTGGGG
GCAGGGCACAGACAAACAAAAAGACAGCAGTAACCTCTGCAGACTTAAATGTCCCTGTCT
GACAGCTTTGAGGAGAGCAGTGGTTCTCCCAGCATGCAGCTGGAGATCTGAGAACGGGCA
GACTGCCTCCTCANNNNNNNNNNCCCTTGTTTGGTAGTGGACTTCCCCGCCGGTATCTTT
TGACAAAATTCCGAGAAAGATCAGACAGCAGCATGGGGATGTGAAATTGGCAGTTGCAGA
CATGTGGTGATACCCAGGCAACCGGGTTGGAGGGGACCTCTAGCAAACTCCAACAGACCT
GCAGTTGAGGGTCCCGTCTGTTAGAAGGAAAACTAACAAACAGAAAGGCCATCCACACCA
AAAACCCATCTGTACATCACCACCATCAAAGACCAAAAGTAGATAAAACCACAAAGATGG
GGAAAAAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved