Pan_troglodytes Locus Mono:24:SNORA7
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:24:SNORA7
Pan_troglodytes
Mono:24:SNORA7
X
SNORA7
1001..1139
2139
GAATTTAGCCCATGACAAGTTCCATCAGTACTTCTCTCATAGGCACTCCATATAAATGT
GAGATCTCAGTGAAAGGGGAGCTTGCTGCCAAAATGTAGTTTCAACACAAGTCCCGTATA
ATCTCTCCACCCATCAACAAAGAAAATTTGAAGCCACCACTGTCTGTGAGGGTAGGCTTT
CTCATTGACTACTGAAAACTAGAAGGAATGTTTCATATATCATTAATGGCTATTTTGCTC
ATAGGATGGATTTTTTTTTTTTTTGAGACAGGGTTTTTCTATGTCACCCAGGCTGGAGTG
CAGCGATATGATCATAGGTCACTGCTGCCTTGAACTCCTGGACTCAAGTGATTCTTCCTA
CTCAGCCTCCCAAGTAGGTGGGACAACAGGTACACACCACCGTGCCCAACTAATTTTTTA
AAAATGTTTTGTAGAGACGGGGTCTCACTTTGTACTCAGACTGGTATTGAATTCTTGATT
TCAAGTTATCCTTCCACCTCAGCCTCCCAAAGTGTTAGGATTACAGGTGTGAGCCACTCT
GCCCAGCCAGGATGGATTTCAAACTAATTTACATTGCAGTGAAACAACTCCCTTGGGCAT
GAAGGAAGAACTGGCTTTAGATGTTCCCTTGTACTATCTGTAATATAACTTCAGATAGGA
AAAGAATAACTTGCTGAAATACAAATAAAATCCAAATCCTCATTTTGGTGAAGAATAGGA
TTTTAGGATTCTCTTTCCTCAAAGTTATTTTCATAAATATAAGGAAAAATAAATTTGAGT
TTCACTATCCCCTTGGTGCCTTTCCCTGCTTAAGTAGCAGAAGCACACAAAGACCTCTAA
TCTACAAACTTGAAAATCCAGAAAGACTATTGTTGTTTAAGAGTTGGTACATGCTGTAAA
GATAGGGAAGGCTTATTAACACAATGTAGAGATGATGAATGAGCCTGTTCAAGTGTAGAT
AACAATGATAAGCTCAGAGCAGCAGATAAAAATGAAGATCCTACCTCCCAGGATGGCATC
TGGAAGTGGATAGTATTCTGCCAGCTTTGGAAACTGGATGAAAAGCAAATCTGGCAGAGG
TACCCATTTCATTCCCAGCTTGCTCAGTAGCTGGTGATTGGAAGAAACTCTGCAACAGTG
TTCAATCCCTGGACAGGAAACCCTCCTTCCATGATTCTTCTTTAACATGGGTCTGAGAAA
AAGAGAAATACAGTATTTTTTAAAATGAAGATGCTAGCCAACTCTCACCAGAACACATAC
TTAAATTGTTTTGCAGATCTTGAGGATGATTTAACCTGATCTGTCCTTTCATTGATTCCT
CTTAAAACCAAGAGCTTGAGCTGGCTGGGTAGGGGTCCAGATTTGGTCACAAAAGAAAGC
CCCAAGCTATTTAGATCAGAACGGGAGGGATGTAGTTCTAGATTGGGTTGGGTATCCTGC
CAGTGAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTCTAGATTGGGTTGGGTATCCTGCCAGTG
GAACCAACTTATCCTGGGCAAGTGTGAACAGATTGAAAGCTTGTTCATTGAAATACGTAG
CGTACTTCTCCTAGGGCATTCAAAACATTTCAAAGAAAGAGCCTCCATGCATAAGTGAAA
TTGAGCATATATACTAATGAGAAGGTGTACAACTCACAAGAGGATAAGGAAAGAGATAAT
AGCTCTCAACATATGTATACTCTGTGACCCAAATTTCTATTCCTAAGTAAATACCCAAGA
AAAAGCATACAGAAAAAACATGTACAAGAAGGTCCATAGCAGTTTAGCCACCTGTTGTGC
ATGTATCTGACACATAATAGGTGCTCAATAAATGTATATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved