Pan_troglodytes Locus Mono:247:SNORA1
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Mono:247:SNORA1
Pan_troglodytes
Mono:247:SNORA1
16
SNORA1
1001..1133
2133
GAGAGGATATCAGTAGAGCCTCTTGATGGTCTTCTCACATCCATCTCCTCTGCACAGCC
CACACGGAGGGTCCTGGGGCAGATTTTGGTGGCTGTGAATCCACGAATCTAACAGAGAGA
CATCACTTCAGAGCAGGCTCTGGACAGTTATGATGTGCTCAGAGTGAGGGCTGGCACTCC
TCACCAGCCCACCTAGCCCAGCCACAGTGCCTGGAACCTGCTCCAACCCATAAACAGGGC
CAATTCTGTAGCCAGAGCTTGACATCCATCTCAGCATGAGTCCAGCCAGTGCAACCACAT
TCCAGGCCCCCAAAAGCCCAGCTTAGAGCTCAAAACAGAGGCCAACAGGAACCTAGGGTC
CAGCGTTGTAGGTCTTTTGCTAGAACTCTTTTGTGAAGATTTTTGCTTTATGATATCAGG
AAGGAAGAGCAAATATCATTTGTGTTTATGCTTCCTGAGTACTTGGGTTAAGCCCTTGAT
TAAGAATGTTTGGGCCCCTGTTGTTACAGCAGATCTTTATTATCTGAGAATAAGGATGCC
TTACAACAGTGATTCTCAACACTGGTTCACACTGGAATTACTTTGGGAAGGGAAGCTTGA
AAAATGCTGAGGCTGGGGTTCTGCTCCCAGGGATTCTTACTTTATCTGGGCATCTGAATT
CCTCTCCTGTCCTCTCCTCTCCTCTCCCCTTCCTTTCTTTTTGAGAGATAGGGTCTTGCT
CTGTCACCAGACTGGAGTGCAGTGGCACAATCATAGCTCACTGCAGCCTCAAACTACTGG
GCTCAAGAAATCCTCCTACCTTAGCCTCCTGAGTAGCTAGGATTACAGGTGCACGCCACC
ATACCCGGCTAATTTTTAAATTATTTTTTTTTTTTTGTAGAGATAGGGTCTTGCTATGTT
GCCCAGGTTGTGGATTTTTCAAAGCTCCTTGGGTGATTAACTGTGCAGCTAACGTCAAGG
ACCACAGCCTTCAGGTGAGTCCACTCAAAAATAGGGACTAAAGCCTCTTTCTAGATGAGA
ATGGGCACTGTCGATCATGGTGTCTGAAAATTGTAAGTGGCTAAATTGAAACACAGGTTA
TGCTTCCATAACAGTATCTGTATCGCAGTGGTGACAATGAGACCTGTAACACTTTGAAAA
TTTTTTTAAGAGAATAAAATAAAAGAAAAAAAACCCAGGGCCTCCTATTCATAGTAAACA
ATCAAGTCCGAAAACATGCTTCCAACTTTATCTGAAAATGAAATTATAATTCAGGAAAAC
ATGCTGATTTTTTTCTGATCTTCTTTAACTATGTACTAGGGTAAACAAAAAAAGTAAGCT
TTGTTGATTTCGGAGTGGCAGGGTTGGGGCATGCATAATTTTTCTGATAAAATTGCGTGG
TAGTCCAGTATGAAATCTTTCCCTGCGCTGACAAGATCATAAAGTTTGACTTTCACAGCA
GGATCATAAAATGGGTCATTTTTGCAAGCAATATTTGAGCCCGTCATCAGTTTTCCTAAG
GGCTCCTGTTAATCCTTTGATATTCAAATCGTTGGATGTGTCTATCACATCATCATTCTT
GTCAATTTTCTCTTCTTCCATTGTTAGCTTGTGTCCCTCCAGCAGGCTCTTGTCTACCCG
TGGTTAACACATCACGTTTTGCCTCCTATTTTCGTTGTATTGTCACGTGTTGACAAGAGC
TGGCAATCAGAAACAGGCTGTCAGACAAAAACCGCGAATTGCAGAGTGTTAAATGGGGCA
GGGGTGTGGCGTGGAGTAGGGAGGGGGTGCCTGTGTAGGGAATGATTTTATAACTGGTCC
GGTCATGAATGCACATATTCATATTAAGACAGAGTTTACTTGCCTGTCCGTGCAACCTTG
CGCACACAGGGATTTGGATAATGAATTCATAGTAACAAGGACCCTGAGCTGAGCTTGGCC
CCTGATCAAGATGAAGCATGTAGGGTATAGCAATTACAAATTACCGCTTCTAATAAGAGA
ACAACGAGTCAGTTTCTGAGAAATAAACATTTTCTTCTGGTGTAAAGAACTGTGGTTGAT
GCACATCCTGATTTATTCTTTTCTCATTCTTTTTTTTTTTTGAGACATGGTCTTGCTCTG
TTGCCCAGGCTGAAGTGCAGTGGCACAATCATGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved